TkA08G097690 | RubberDandelionOmics

Gene overview

TkA08G097690

Reference: TK1151 Chr: Chr08 Coordinates: 25265789-25273945 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3480 bp · TkA08G097690|TK1151|cDNA

AAGAAATTACATGGGTATAACATGGGTATAACAGGGAATCAATTGATCAATTGATTCATAGGACATCTGAAGTTACAATGATTCACCATGAATCATTGTTTGGACCAAATGAATCAACATGTGGTAGTGAATCAGGTTCTAATGGAATTAAGAAGTTACATGGGTATAACATAGTGTATTTCTAATGAATCATAACAAGTGAAACAATTGATAAATTGATTCATACGAACATATGATTCATGAATATACATTGATTCAGT...

CDS

Download CDS FASTA

2274 bp · TkA08G097690|TK1151|CDS

ATGTCCATGGATAGGAGAGAGGCTGATCTACCGGCGGACAATCCAGATTCAAATTTACACCGTTCGTTTAATGTAACAACGTCGTCTTCAGCATCATCTGTTTCCTCCGACTTCCTCCGCGACTTACAAGCCGCCTGTAAGCGCCGCCCTGCAGGTATGATGCCACAAATGAAGCCAATACGTTTAGTTGCTAGAGGGGAAACAAGAAAGAGCTCAGATCCAGCAGTCCAGTCCCAAATGATAGACGAGTCTCCCCATAT...

Protein

Download Protein FASTA

757 aa · TkA08G097690|TK1151|PROTEIN

MSMDRREADLPADNPDSNLHRSFNVTTSSSASSVSSDFLRDLQAACKRRPAGMMPQMKPIRLVARGETRKSSDPAVQSQMIDESPHIQHLSKKMQDYISQTRSMLSSSHVTHEDASITPPTVSGKTNDVGNPTSIDTERCQPSFGTSCTSNNTACSSIIEHDNGPLVDGPKKVQFALQKNTRFHEMECDGSNQLDVSAAHQNFQNMDVDPCLKTNDEIHSLNLKSSIGGQDQIDHFRNFLQRDFGHNMTQSSVAGSSCAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G097690`
TK1151 ID	TkA08G097690
OH-1004 ID	LXL04_031258
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G097690

Location Chr08:25265789-25273945 (+)

Description Similar to MPS1: Serine/threonine-protein kinase MPS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77720`	Involved in the regulation of the onset of mitosis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031258 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007051 spindle organization Biological Process

GO:0007052 mitotic spindle organization Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process

GO:0007127 meiosis I Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0031134 sister chromatid biorientation Biological Process

GO:0033316 meiotic spindle assembly checkpoint signaling Biological Process

GO:0034501 protein localization to kinetochore Biological Process

GO:0044779 meiotic spindle checkpoint signaling Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0051225 spindle assembly Biological Process

KEGG gene cross-reference

ath:AT1G77720

ddi:DDB_G0280995

hsa:7272

sce:YDL028C

spo:2540060

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.527

Rank 1 · TkA08G097690 · TK1151

Cytoplasm0.498

Rank 2 · TkA08G097690 · TK1151

Cell membrane0.058

Rank 3 · TkA08G097690 · TK1151

Mitochondrion0.054

Rank 4 · TkA08G097690 · TK1151

Golgi apparatus0.037

Rank 5 · TkA08G097690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01163RIO189-115 aa

PF00069Pkinase397-692 aa

PF07714PK_Tyr_Ser-Thr402-688 aa

PF06293Kdo521-577 aa

PF01163RIO1522-568 aa

PF14531Kinase-like532-635 aa

PF03109ABC1535-577 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G097690	`PF01163`	RIO1	89	115	0.017	15.5
TkA08G097690	`PF00069`	Pkinase	397	692	2.3e-56	191.8
TkA08G097690	`PF07714`	PK_Tyr_Ser-Thr	402	688	3.3e-21	76.5
TkA08G097690	`PF06293`	Kdo	521	577	0.03	14.5
TkA08G097690	`PF01163`	RIO1	522	568	0.017	15.5
TkA08G097690	`PF14531`	Kinase-like	532	635	0.018	15.0
TkA08G097690	`PF03109`	ABC1	535	577	0.0034	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84VX4`	Arabidopsis thaliana	sp\|Q84VX4\|MPS1_ARATH Serine/threonine-protein kinase MPS1	51.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card