TkA08G096200 | RubberDandelionOmics

Gene overview

TkA08G096200

Reference: TK1151 Chr: Chr08 Coordinates: 24889978-24901795 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2460 bp · TkA08G096200|TK1151|cDNA

ATTTTTGGAACAAGTAAGACACCCTACTCTACTCTTAAACGACACTGTCGACACATATAAATTATAATCGTGCCAAACAATTGTATTCACCTTCTTTGGTGTTGTTGTCTTTCCATGGAGTTTGCTGGCACTTGTCACATACTCTCTTTTGGCTTTTACCCTTTTACGCTTCTTTCTCGGAGCGAATTCTGGACCCCACTGTCCACCCCCATTCATTGAACCTGCAATAAACCCTCGTCATTTCATCATACAGATCTCTC...

CDS

Download CDS FASTA

1134 bp · TkA08G096200|TK1151|CDS

ATGGCAGGATTTCTTCGGGAAATTGATGAAGGAAGTGATGGACAAACAAGAGGAACTACAAAAAGGTTTCTTGAGACAATCGAGAGACGGGAGAGAGACCGAGTGGCGAGGGAGGAGGCTTGGCGAGCACAAGAGATTGCCAAGATGAACCAAGAACACGATCGATTACTCAAAGAGAGATCAATCGCCGCCGCAAAAGATGCCGCCGTCATCACGTTTCTGCAGAAGATGACCGGTAAAACCCCTGACACGGTGGACGA...

Protein

Download Protein FASTA

377 aa · TkA08G096200|TK1151|PROTEIN

MAGFLREIDEGSDGQTRGTTKRFLETIERRERDRVAREEAWRAQEIAKMNQEHDRLLKERSIAAAKDAAVITFLQKMTGKTPDTVDETRKRLADFLAPPPLALTLPVIQQQIHQTPPPIQRPPPPPHHEVLQVAVPPRTPMVKNLDGDGSGGDNILSPSPSRWPKAEINALITLRTQLDMNYTENTPKGPLWEEISAAMRKLGYNRNAKRCKEKWENINKYYKKMKDGNKKRPEDSKTCPYFHQLDAIYREKATAIIARP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G096200`
TK1151 ID	TkA08G096200
OH-1004 ID	LXL04_031235
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 94.695 / OH-1004 56.398 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G096200

Location Chr08:24889978-24901795 (-)

Description Similar to GT-2: Trihelix transcription factor GT-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76880`	Transcription repressor that negatively regulates root hair growth by directly binding RSL4 promoter and repressing RSL4 expression.	No verified direct reference in this release
`At1g76890`	Probable transcription factor that binds specific DNA sequence.	No verified direct reference in this release
`At1g33240`	Transcription repressor that binds specific DNA sequence such as GT3 box 5'-GGTAAA-3' in the SDD1 promoter.	The trihelix transcription factor GTL1 regulates ploidy-dependent cell growth in the Arabidopsis trichome.2009 · DOI: 10.1105/tpc.109.068387 The Arabidopsis GTL1 transcription factor regulates water use efficiency and drought tolerance by modulating stomatal density via transrepression of SDD1.2010 · DOI: 10.1105/tpc.110.078691 GTL1 and DF1 regulate root hair growth through transcriptional repression of ROOT HAIR DEFECTIVE 6-LIKE 4 in Arabidopsis.2018 · DOI: 10.1242/dev.159707
`At5g28300`	Probable transcription factor that binds specific DNA sequence.	No verified direct reference in this release
`At5g03680`	Transcription factor that prevents growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031235 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0046621 negative regulation of organ growth Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0048358 mucilage pectin biosynthetic process Biological Process

GO:0048441 petal development Biological Process

GO:0048442 sepal development Biological Process

GO:0048498 establishment of petal orientation Biological Process

GO:0048768 root hair cell tip growth Biological Process

KEGG gene cross-reference

ath:AT1G76880

ath:AT1G76890

ath:AT5G03680

ath:AT5G28300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · TkA08G096200 · TK1151

Cytoplasm0.063

Rank 2 · TkA08G096200 · TK1151

Cell membrane0.030

Rank 3 · TkA08G096200 · TK1151

Endoplasmic reticulum0.024

Rank 4 · TkA08G096200 · TK1151

Plastid0.011

Rank 5 · TkA08G096200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30599DUF866117-116 aa

PF13873Myb_DNA-bind_521-47 aa

PF10545MADF_DNA_bdg32-43 aa

PF13837Myb_DNA-bind_4161-248 aa

PF13921Myb_DNA-bind_6163-224 aa

PF10545MADF_DNA_bdg181-246 aa

PF13873Myb_DNA-bind_5184-224 aa

PF19940DUF6402193-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G096200	`PF30599`	DUF8661	17	116	0.019	15.9
TkA08G096200	`PF13873`	Myb_DNA-bind_5	21	47	0.033	14.8
TkA08G096200	`PF10545`	MADF_DNA_bdg	32	43	4.8e-05	24.3
TkA08G096200	`PF13837`	Myb_DNA-bind_4	161	248	1.7e-26	93.2
TkA08G096200	`PF13921`	Myb_DNA-bind_6	163	224	0.0013	19.5
TkA08G096200	`PF10545`	MADF_DNA_bdg	181	246	4.8e-05	24.3
TkA08G096200	`PF13873`	Myb_DNA-bind_5	184	224	0.033	14.8
TkA08G096200	`PF19940`	DUF6402	193	236	0.049	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C6K3`	Arabidopsis thaliana	sp\|Q9C6K3\|DF1_ARATH Trihelix transcription factor DF1	55.600%	Swiss-Prot	Medium
`Q39117`	Arabidopsis thaliana	sp\|Q39117\|TGT2_ARATH Trihelix transcription factor GT-2	50.000%	Swiss-Prot	Medium
`Q9C882`	Arabidopsis thaliana	sp\|Q9C882\|GTL1_ARATH Trihelix transcription factor GTL1	44.500%	Swiss-Prot	Medium
`Q8H181`	Arabidopsis thaliana	sp\|Q8H181\|GTL2_ARATH Trihelix transcription factor GTL2	34.800%	Swiss-Prot	Medium
`Q9LZS0`	Arabidopsis thaliana	sp\|Q9LZS0\|PTL_ARATH Trihelix transcription factor PTL	44.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card