TkA08G095220 | RubberDandelionOmics

Gene overview

TkA08G095220

Reference: TK1151 Chr: Chr08 Coordinates: 24600342-24602720 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1353 bp · TkA08G095220|TK1151|cDNA

TGGTGTATGGTGAGTTGAAGGTGTACGTGGGCGTAGCAAAATTCAAGTACTAGGAGCTCTTTGCGAATCGAAATTTCAACGAGTCGTTGGAAGTTGGAACACCAAGAATCAAAGTTAAATGCGATCAGAAGCTCCAACAATTACGTTGCGCCTTCAATTTCGTATCTCACTTCCATTTCTAGCAATGTTCATCGTCAAGGCATGGAGATCAACTGCTTTCGGCATTTATGGCTACCTCAATTTCACAAAATCTGGCTTCT...

CDS

Download CDS FASTA

1035 bp · TkA08G095220|TK1151|CDS

ATGCGATCAGAAGCTCCAACAATTACGTTGCGCCTTCAATTTCGTATCTCACTTCCATTTCTAGCAATGTTCATCGTCAAGGCATGGAGATCAACTGCTTTCGGCATTTATGGCTACCTCAATTTCACAAAATCTGGCTTCTTGGAACACTCTAAGAATTTCAAACCAGAAGATATGTCAACTCGAATAGACGGAAAGAATTGCATAGTAACCGGAGCTAATTCAGGGATCGGTTATGCCGCCGCTGAGGGTCTTGCATC...

Protein

Download Protein FASTA

344 aa · TkA08G095220|TK1151|PROTEIN

MRSEAPTITLRLQFRISLPFLAMFIVKAWRSTAFGIYGYLNFTKSGFLEHSKNFKPEDMSTRIDGKNCIVTGANSGIGYAAAEGLASRGANVYMVCRNKERGEAALSKIISTTGNQNVHLEVCDISCINDVKSFASRFKAKDVPVHVLVNNAGALENKRVTTSEGYEMNFAVNVLGTYGLTELMLPLLEKSQPDARVITVSSGGMYTAPLNTDLQFKDGEFNGVEQYARNKRVQIALTEKWAEKYGNKGIGFYAMHPGWA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G095220`
TK1151 ID	TkA08G095220
OH-1004 ID	LXL04_031214
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G095220`
Location	Chr08:24600342-24602720 (+)
Description	Similar to DHRS12: Dehydrogenase/reductase SDR family member 12
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031214` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001523 retinoid metabolic process Biological Process GO:0042572 retinol metabolic process Biological Process GO:0042574 retinal metabolic process Biological Process GO:0110095 cellular detoxification of aldehyde Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0004745 all-trans-retinol dehydrogenase (NAD+) activity Molecular Function GO:0016491 oxidoreductase activity Molecular Function GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0033721 aldehyde dehydrogenase (NADP+) activity Molecular Function GO:0052650 all-trans-retinol dehydrogenase (NADP+) activity Molecular Function GO:0102354 11-cis-retinol dehydrogenase (NADP+) activity Molecular Function
KEGG gene cross-reference	bta:369021 bta:507276 hsa:51109 hsa:79758 mmu:17252 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.312

Rank 1 · TkA08G095220 · TK1151

Mitochondrion0.207

Rank 2 · TkA08G095220 · TK1151

Endoplasmic reticulum0.140

Rank 3 · TkA08G095220 · TK1151

Plastid0.136

Rank 4 · TkA08G095220 · TK1151

Peroxisome0.131

Rank 5 · TkA08G095220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13738Pyr_redox_334-171 aa

PF00106adh_short66-266 aa

PF01370Epimerase69-253 aa

PF08659KR69-207 aa

PF16363GDP_Man_Dehyd70-248 aa

PF13561adh_short_C272-294 aa

PF00107ADH_zinc_N76-106 aa

PF29612pXO2-29_C146-164 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G095220	`PF13738`	Pyr_redox_3	34	171	0.0047	16.9
TkA08G095220	`PF00106`	adh_short	66	266	4.7e-26	92.2
TkA08G095220	`PF01370`	Epimerase	69	253	1.3e-10	41.9
TkA08G095220	`PF08659`	KR	69	207	3.3e-10	40.9
TkA08G095220	`PF16363`	GDP_Man_Dehyd	70	248	5.2e-06	26.9
TkA08G095220	`PF13561`	adh_short_C2	72	294	9.8e-22	78.4
TkA08G095220	`PF00107`	ADH_zinc_N	76	106	0.17	12.6
TkA08G095220	`PF29612`	pXO2-29_C	146	164	0.19	12.4
TkA08G095220	`PF29612`	pXO2-29_C	274	335	0.19	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card