TkA08G094000 | RubberDandelionOmics

Gene overview

TkA08G094000

Reference: TK1151 Chr: Chr08 Coordinates: 24359751-24361265 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1437 bp · TkA08G094000|TK1151|cDNA

TTTTTAACAACAAAGCAACACCCTCTAGAAACCAAAAAAGGATACTCATATAAGTCATAGGGATCGTCATTCTCATCTCTTCAGTCATCCAGCTTATCCACTACCTCCCAGAAAAAAAGAAAAAAATGGCAGAAACCCGGATCCGATTCGGAATTATGGGCTGTGCTAACATAGCCCGCAAGGTATCTAGGGCCATGCTCCTCTCCCCTAACACCACCATCTCCGCCATCGGCAGCCGATCTCTAGAAAAGGCAACTGCT...

CDS

Download CDS FASTA

1086 bp · TkA08G094000|TK1151|CDS

ATGGCAGAAACCCGGATCCGATTCGGAATTATGGGCTGTGCTAACATAGCCCGCAAGGTATCTAGGGCCATGCTCCTCTCCCCTAACACCACCATCTCCGCCATCGGCAGCCGATCTCTAGAAAAGGCAACTGCTTTCGCATCGGAAAACCACTTCCCGGAATCCACCAAAAAGTACGGCAGCTACGAAGCCGTCTTGGACGATCCTGACGTTGACGCCGTTTACGTTCCGTTACCGACTAGCCTTCATTTGCGGTGGGC...

Protein

Download Protein FASTA

361 aa · TkA08G094000|TK1151|PROTEIN

MAETRIRFGIMGCANIARKVSRAMLLSPNTTISAIGSRSLEKATAFASENHFPESTKKYGSYEAVLDDPDVDAVYVPLPTSLHLRWAVLAAEKGKHVLLEKPVALNVGELDKILEACESSGVQFMDATMWMHHPRTVKMKEALSDTQRFGQLKSVHSTFSYVGEGDFLKNDIRVNPNLDSLGALGDAGWYSIRAILWAYDYELPKTVTAFQDTEYNESGVILSCGASLNWKEDGKVATFYCSFLTNLCMDITALGTKGNL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G094000`
TK1151 ID	TkA08G094000
OH-1004 ID	LXL04_031204
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 39.845 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G094000

Location Chr08:24359751-24361265 (-)

Description Similar to At4g09670: Uncharacterized oxidoreductase At4g09670

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g09670`	Uncharacterized oxidoreductase At4g09670.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031204 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0047837 D-xylose 1-dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference

ath:AT4G09670

hvo:HVO_B0029

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.722

Rank 1 · TkA08G094000 · TK1151

Nucleus0.245

Rank 2 · TkA08G094000 · TK1151

Endoplasmic reticulum0.076

Rank 3 · TkA08G094000 · TK1151

Peroxisome0.068

Rank 4 · TkA08G094000 · TK1151

Cell membrane0.062

Rank 5 · TkA08G094000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01408GFO_IDH_MocA6-125 aa

PF22725GFO_IDH_MocA_C3143-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G094000	`PF01408`	GFO_IDH_MocA	6	125	3e-23	83.5
TkA08G094000	`PF22725`	GFO_IDH_MocA_C3	143	260	3.7e-10	40.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZ83`	Arabidopsis thaliana	sp\|Q9SZ83\|Y4967_ARATH Uncharacterized oxidoreductase At4g09670	63.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card