TkA08G092530 | RubberDandelionOmics

Gene overview

TkA08G092530

Reference: TK1151 Chr: Chr08 Coordinates: 23971288-23977623 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4198 bp · TkA08G092530|TK1151|cDNA

TGGTAATGTGACTGGATATTCCCGGTCCCTTTACCTAACTATACCGGTTTTTAAAAGTTCGTTACTTTACTTAGCACGAAATAAAGTACGTTACCTTATTTTGCAAAATGAAGAAAGTAAATTACCCATACAATTCATTATCCAAACTTTTTATCGACCCGTCTCGATCATCCATTTTGAAAAACTCGTATTTAATCGGGTAATCCGTTAAAAACTTAACCGACCACCGGTGGTGGACGCTACTGATGATCTCATATTGG...

CDS

Download CDS FASTA

3336 bp · TkA08G092530|TK1151|CDS

ATGGAGAAGGAAGACTCGACTGAGAAGAAAACAGTTGGTTCTCCTGCTCCTGAGGATGCAAAGAAGGTAGATGCACCTGAAGGAGAAGATCATAACGTTAATACTCCTATTAAAAATGAGTTATCAGGTGGTGAAATGGTGGGAACTACTAATGATACTGATGAAAAGAAACATATCCTTCAAGAAGAACATCAGGATAGAGAACCTTCAACTACAAAGCATTTGTCAGACAATAAAGTTGACGAAACTGCAGTAGATGA...

Protein

Download Protein FASTA

1111 aa · TkA08G092530|TK1151|PROTEIN

MEKEDSTEKKTVGSPAPEDAKKVDAPEGEDHNVNTPIKNELSGGEMVGTTNDTDEKKHILQEEHQDREPSTTKHLSDNKVDETAVDDQKMASDMHGLQQEIETSSNRNLVDDPKDVEIKSQEENMSIDKTTSTSSVEPSNSENSINGVPVILKEDKEKGISVNDTTSDIDVRGHEEEHSTNNSLSNSENATNSLTGELDIQKEEQEKGNTVNDTTIGSTASDTDEKGNSVNDTTIHSTASDTDKKGNSVNDTTINSTASD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G092530`
TK1151 ID	TkA08G092530
OH-1004 ID	LXL04_031191
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G092530`
Location	Chr08:23971288-23977623 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031191` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009263 deoxyribonucleotide biosynthetic process Biological Process GO:0034599 cellular response to oxidative stress Biological Process GO:0045454 cell redox homeostasis Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0015035 protein-disulfide reductase activity Molecular Function GO:0015038 glutathione disulfide oxidoreductase activity Molecular Function GO:0043295 glutathione binding Molecular Function
KEGG gene cross-reference	ecc:c4433 ece:Z5037 ecj:JW3585 eco:b3610 ecoc:C3026_19575 ecs:ECs_4488 pae:PA5129 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.442

Rank 1 · TkA08G092530 · TK1151

Cell membrane0.337

Rank 2 · TkA08G092530 · TK1151

Nucleus0.210

Rank 3 · TkA08G092530 · TK1151

Endoplasmic reticulum0.086

Rank 4 · TkA08G092530 · TK1151

Golgi apparatus0.083

Rank 5 · TkA08G092530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00610DEP203-222 aa

PF14595Thioredoxin_9489-519 aa

PF04784DUF547583-597 aa

PF14595Thioredoxin_9611-665 aa

PF00462Glutaredoxin645-702 aa

PF00610DEP766-833 aa

PF04784DUF547911-1038 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G092530	`PF00610`	DEP	203	222	1.6e-17	63.9
TkA08G092530	`PF14595`	Thioredoxin_9	489	519	0.38	11.3
TkA08G092530	`PF04784`	DUF547	583	597	2.4e-38	131.6
TkA08G092530	`PF14595`	Thioredoxin_9	611	665	0.38	11.3
TkA08G092530	`PF00462`	Glutaredoxin	645	702	2.7e-12	47.4
TkA08G092530	`PF00610`	DEP	766	833	1.6e-17	63.9
TkA08G092530	`PF04784`	DUF547	911	1038	2.4e-38	131.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card