TkA08G089590 | RubberDandelionOmics

Gene overview

TkA08G089590

Reference: TK1151 Chr: Chr08 Coordinates: 23199534-23200724 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

911 bp · TkA08G089590|TK1151|cDNA

GAAAATTTCATATATATCCTTATAAAAACTAAATATTACTTCTATATCCTTCTAATATTAACATCCCAAAATTCACAAATTTCTGATCATCTTCAATCAAGTTCAAGATTTTATAATAGAATGGCGAATCCCATCGTTCTTTGTTCAGGTAAGTTGCTGAGTAGCTCTGAGTATTCAAAGAGATTTCCTCTTCTTCCTCTTGTAATCAGAAAGCAAAAATCCGCCATCGGGTTCCATGGTCACCCACTGCATATTACCGG...

CDS

Download CDS FASTA

759 bp · TkA08G089590|TK1151|CDS

GAAAATTTCATATATATCCTTATAAAAACTAAATATTACTTCTATATCCTTCTAATATTAACATCCCAAAATTCACAAATTTCTGATCATCTTCAATCAAGTTCAAGATTTTATAATAGAATGGCGAATCCCATCGTTCTTTGTTCAGGTAAGTTGCTGAGTAGCTCTGAGTATTCAAAGAGATTTCCTCTTCTTCCTCTTGTAATCAGAAAGCAAAAATCCGCCATCGGGTTCCATGGTCACCCACTGCATATTACCGG...

Protein

Download Protein FASTA

252 aa · TkA08G089590|TK1151|PROTEIN

ENFIYILIKTKYYFYILLILTSQNSQISDHLQSSSRFYNRMANPIVLCSGKLLSSSEYSKRFPLLPLVIRKQKSAIGFHGHPLHITGTITSSQPRRGFFVYSFQPGNHDDDHHHATSGDSPSSWQQWIVRIITTVIVPFFRRKWTKLLLLAIKDEVDTVVEEAEKIVECVEEAAETVDKVARDVAEHLPEGGRWRNAAMFVEDVAEEVAREAQLVEDLLHDVEEIEEKVELLVESVKDQPKNIHQDLKKNTN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G089590`
TK1151 ID	TkA08G089590
OH-1004 ID	LXL04_031142
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	90.200
Protein coverage (%)	TK1151 80.952 / OH-1004 52.713 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G089590`
Location	Chr08:23199534-23200724 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031142` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.936

Rank 1 · TkA08G089590 · TK1151

Mitochondrion0.060

Rank 2 · TkA08G089590 · TK1151

Nucleus0.039

Rank 3 · TkA08G089590 · TK1151

Cytoplasm0.034

Rank 4 · TkA08G089590 · TK1151

Cell membrane0.018

Rank 5 · TkA08G089590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12186AcylCoA_dehyd_C19-43 aa

PF12447DUF3683146-179 aa

PF08702Fib_alpha148-249 aa

PF01519DUF16148-183 aa

PF00015MCPsignal150-186 aa

PF01442Apolipoprotein151-188 aa

PF12186AcylCoA_dehyd_C151-185 aa

PF06103DUF948152-186 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G089590	`PF12186`	AcylCoA_dehyd_C	19	43	8.1	7.3
TkA08G089590	`PF12447`	DUF3683	146	179	0.82	10.5
TkA08G089590	`PF08702`	Fib_alpha	148	249	0.11	13.4
TkA08G089590	`PF01519`	DUF16	148	183	2.0	9.7
TkA08G089590	`PF00015`	MCPsignal	150	186	1.2	9.7
TkA08G089590	`PF01442`	Apolipoprotein	151	188	0.095	13.1
TkA08G089590	`PF12186`	AcylCoA_dehyd_C	151	185	8.1	7.3
TkA08G089590	`PF06103`	DUF948	152	186	0.011	16.7
TkA08G089590	`PF20663`	COG4_N	152	206	0.096	13.5
TkA08G089590	`PF12732`	YtxH	152	184	0.11	13.7
TkA08G089590	`PF06248`	Zw10_N	154	187	2.9	9.3
TkA08G089590	`PF07889`	DUF1664	154	184	3.1	8.6
TkA08G089590	`PF18460`	HetR_C	154	188	5.4	7.7
TkA08G089590	`PF19103`	DUF5790	154	185	6.5	8.1
TkA08G089590	`PF28971`	COR15	155	209	3.9	8.1
TkA08G089590	`PF25920`	DUF7966	156	179	0.63	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card