TkA08G089580 | RubberDandelionOmics

Gene overview

TkA08G089580

Reference: TK1151 Chr: Chr08 Coordinates: 23196703-23197917 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

868 bp · TkA08G089580|TK1151|cDNA

AAGCAACCTTCAACATTTGACCATGAAAAAAAAAACATTTTGCCAAACTTCAGAACGTTGTCATCTACAAAAGAAACCTTAAAGCACACAATCTCTATACCTTGACAACAAACTTTACTTTCAGAGTTTAATGGCTAGATCAAAAGGTATTTCGTATGGTCGTTTAATAGTCAAAAACCTATACACTACACACATATCGACGTCTTCCAACACACAAATTCTCAAAGACATCACTGGTTGTCGTATGGGTGGATCTCAAT...

CDS

Download CDS FASTA

558 bp · TkA08G089580|TK1151|CDS

ATGGCTAGATCAAAAGGTATTTCGTATGGTCGTTTAATAGTCAAAAACCTATACACTACACACATATCGACGTCTTCCAACACACAAATTCTCAAAGACATCACTGGTTGTCGTATGGGTGGATCTCAATCACGAAGAACATTTTGCAGTTTTAGTGGCAATCAAAAACTTCCTCCACCAACACCACCACCTCCACCTCCGAGTTCAAATTGGGGAAAATGGACCGCTGGAATGGTGGTGGCAATTGTTATACCGTTGCT...

Protein

Download Protein FASTA

185 aa · TkA08G089580|TK1151|PROTEIN

MARSKGISYGRLIVKNLYTTHISTSSNTQILKDITGCRMGGSQSRRTFCSFSGNQKLPPPTPPPPPPSSNWGKWTAGMVVAIVIPLLQFKEEVDVVMETAEEIIDVIEVAAEAVDMVAEKIVADLPDSSTFRTTMEKIEEVAETVAGKAQKAVDFIDEIQEAEQKLGPIIEPVKQQTQATPSEAS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G089580`
TK1151 ID	TkA08G089580
OH-1004 ID	LXL04_031142
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 47.804 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G089580`
Location	Chr08:23196703-23197917 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031142` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.557

Rank 1 · TkA08G089580 · TK1151

Mitochondrion0.395

Rank 2 · TkA08G089580 · TK1151

Cytoplasm0.044

Rank 3 · TkA08G089580 · TK1151

Nucleus0.041

Rank 4 · TkA08G089580 · TK1151

Extracellular0.018

Rank 5 · TkA08G089580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16101PRIMA142-68 aa

PF26039Dcst276-125 aa

PF06103DUF94878-164 aa

PF04691ApoC-I90-107 aa

PF26891Phage_N4_Gp193-156 aa

PF19014DUF574394-166 aa

PF03822NAF96-119 aa

PF11101DUF2884101-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G089580	`PF16101`	PRIMA1	42	68	0.1	13.1
TkA08G089580	`PF26039`	Dcst2	76	125	1.0	9.2
TkA08G089580	`PF06103`	DUF948	78	164	0.51	11.3
TkA08G089580	`PF04691`	ApoC-I	90	107	0.21	12.3
TkA08G089580	`PF26891`	Phage_N4_Gp1	93	156	0.11	13.5
TkA08G089580	`PF19014`	DUF5743	94	166	0.17	11.8
TkA08G089580	`PF03822`	NAF	96	119	0.36	11.7
TkA08G089580	`PF11101`	DUF2884	101	156	0.056	13.8
TkA08G089580	`PF05517`	p25-alpha	102	179	0.25	12.3
TkA08G089580	`PF28971`	COR15	103	159	0.22	12.2
TkA08G089580	`PF04691`	ApoC-I	128	157	0.21	12.3
TkA08G089580	`PF03822`	NAF	131	145	0.36	11.7
TkA08G089580	`PF26039`	Dcst2	132	166	1.0	9.2
TkA08G089580	`PF06103`	DUF948	133	174	0.51	11.3
TkA08G089580	`PF26891`	Phage_N4_Gp1	138	166	0.11	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card