TkA08G087820 | RubberDandelionOmics

Gene overview

TkA08G087820

Reference: TK1151 Chr: Chr08 Coordinates: 22760813-22763442 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

789 bp · TkA08G087820|TK1151|cDNA

TTAACTTGGGATGATTCACCTCTTTCAAATTCTAGTGATCGTCCCTCTCTCAGAACCCTAGTTATCGAAATTCTATCTACCAAATCGCCCTCAGTGAACAAAATTTCACATCATCGAGTTTTCGTGCCACCAGGAACAATGAGTCGCTCTAGCAGAACGCTGTATGTTGGCAATCTTCCTGGGGATATTCGCGAGCGAGAAGTGGAAGATTTGTTTTACAAGTATGGTCCAATAGCGCATATTGATCTGAAAATTCCACC...

CDS

Download CDS FASTA

789 bp · TkA08G087820|TK1151|CDS

TTAACTTGGGATGATTCACCTCTTTCAAATTCTAGTGATCGTCCCTCTCTCAGAACCCTAGTTATCGAAATTCTATCTACCAAATCGCCCTCAGTGAACAAAATTTCACATCATCGAGTTTTCGTGCCACCAGGAACAATGAGTCGCTCTAGCAGAACGCTGTATGTTGGCAATCTTCCTGGGGATATTCGCGAGCGAGAAGTGGAAGATTTGTTTTACAAGTATGGTCCAATAGCGCATATTGATCTGAAAATTCCACC...

Protein

Download Protein FASTA

262 aa · TkA08G087820|TK1151|PROTEIN

LTWDDSPLSNSSDRPSLRTLVIEILSTKSPSVNKISHHRVFVPPGTMSRSSRTLYVGNLPGDIREREVEDLFYKYGPIAHIDLKIPPRPPGYAFVEFEEARDAEDAIRGRDGYDFDGHRLRVELAHGGRGNSSSTDRHGGGGGGRGGGVSRRSDYRVMVTGLPSSASWQDLKDHMRRAGDVCFSQVFREGSGTTGIVDYTNYDDMKYADTKLDDSEFRNAFARGYIRVKEYDSSHSRSRSRRSRSKSRSYSRSREVEAEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G087820`
TK1151 ID	TkA08G087820
OH-1004 ID	LXL04_018887
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.400
Protein coverage (%)	TK1151 75.954 / OH-1004 65.823 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G087820

Location Chr08:22760813-22763442 (-)

Description Similar to SR34: Serine/arginine-rich-splicing factor SR34

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g02840`	General splicing factor.	atSRp30, one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of specific plant genes.1999 · DOI: 10.1101/gad.13.8.987
`At4g02430`	Probably involved in intron recognition and spliceosome assembly.	No verified direct reference in this release
`At1g09140`	Regulatory splicing factor that modulates alternative splicing and gene expression in specific cell types.	atSRp30, one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of specific plant genes.1999 · DOI: 10.1101/gad.13.8.987
`At3g49430`	Probably involved in intron recognition and spliceosome assembly.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018887 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0035061 interchromatin granule Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G02840

ath:AT1G09140

ath:AT3G49430

ath:AT4G02430

gga:772264

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.903

Rank 1 · TkA08G087820 · TK1151

Cytoplasm0.299

Rank 2 · TkA08G087820 · TK1151

Cell membrane0.024

Rank 3 · TkA08G087820 · TK1151

Endoplasmic reticulum0.018

Rank 4 · TkA08G087820 · TK1151

Extracellular0.014

Rank 5 · TkA08G087820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367RRM_751-79 aa

PF14703PHM7_cyt51-78 aa

PF16842RRM_occluded52-122 aa

PF25701RRM_YTH153-73 aa

PF00076RRM_154-121 aa

PF14703PHM7_cyt88-107 aa

PF25701RRM_YTH1153-219 aa

PF14703PHM7_cyt155-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G087820	`PF16367`	RRM_7	51	79	0.0016	19.1
TkA08G087820	`PF14703`	PHM7_cyt	51	78	0.02	15.8
TkA08G087820	`PF16842`	RRM_occluded	52	122	0.00094	19.7
TkA08G087820	`PF25701`	RRM_YTH1	53	73	0.002	18.6
TkA08G087820	`PF00076`	RRM_1	54	121	2.9e-29	101.4
TkA08G087820	`PF14703`	PHM7_cyt	88	107	0.02	15.8
TkA08G087820	`PF25701`	RRM_YTH1	153	219	0.002	18.6
TkA08G087820	`PF14703`	PHM7_cyt	155	183	0.02	15.8
TkA08G087820	`PF16367`	RRM_7	156	182	0.0016	19.1
TkA08G087820	`PF00076`	RRM_1	157	219	2.9e-29	101.4
TkA08G087820	`PF00937`	CoV_nucleocap	227	258	0.89	9.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22315`	Arabidopsis thaliana	sp\|O22315\|SR34_ARATH Serine/arginine-rich-splicing factor SR34	73.800%	Swiss-Prot	High
`F4JHI7`	Arabidopsis thaliana	sp\|F4JHI7\|SR34B_ARATH Serine/arginine-rich splicing factor SR34B	71.900%	Swiss-Prot	High
`Q9XFR5`	Arabidopsis thaliana	sp\|Q9XFR5\|SR30_ARATH Serine/arginine-rich splicing factor SR30	72.000%	Swiss-Prot	High
`A2RVS6`	Arabidopsis thaliana	sp\|A2RVS6\|SR34A_ARATH Serine/arginine-rich splicing factor SR34A	70.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card