TkA08G085940 | RubberDandelionOmics

Gene overview

TkA08G085940

Reference: TK1151 Chr: Chr08 Coordinates: 22151008-22156579 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2589 bp · TkA08G085940|TK1151|cDNA

TTTCTATCTCTATTTCCTACGCTAACAGTTTAAGCTAACAACTTCGTGGCACACTCGTTGTGTTCGGCGCTTCTCGCCGGTTGCTGCCGCCCTACCTCCTTCCTACTCCGTCATTCACCCCAATCGGAAACAAATCACCTCCAAGGACTCTGTTTATTTCATTGATTCTATTTTATTTCCGATAATTAAGGTAGCATTTGATTATTTCAAGGAACATAAAATGGCAACCATTTCAGATATAACGGTATCAGCTGCCATTA...

CDS

Download CDS FASTA

2301 bp · TkA08G085940|TK1151|CDS

ATGGCAACCATTTCAGATATAACGGTATCAGCTGCCATTAACAGTCTATCAGCATTATTTTTCCTAATTGCATTTGCAATTTTACGCCTTCAACCCATAAACGACCGAGTTTATTTTCCAAAATGGTATCTCAAAGGCATAAGAGAAAATCCAAGTACTTCAGGACCTTTTGTAAAGAAATTTGTGAATCTTGATTTTAGAATGTATTTAAGATTCTTAAATTGGGTGCCTGCGGCTTTAAGAATGCCTCAACCCGAGCT...

Protein

Download Protein FASTA

766 aa · TkA08G085940|TK1151|PROTEIN

MATISDITVSAAINSLSALFFLIAFAILRLQPINDRVYFPKWYLKGIRENPSTSGPFVKKFVNLDFRMYLRFLNWVPAALRMPQPELIDHAGLDSAVYIRIYLLGLKIFVPIALVAFGVLLPVNYTAGNYQDIKVNMKDITFGEIDKFSISNVPPGSKRLIVHIVLAYVFTFWTCYILYKEYKIVTNMRLRFLASENRRPDQFTVLVRNVPPDPDETVSEHVEHFFIVNHPDQYLVHKVVHNANKLASMVEKSKDLHNRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G085940`
TK1151 ID	TkA08G085940
OH-1004 ID	LXL04_018838
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 49.676 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G085940

Location Chr08:22151008-22156579 (+)

Description Similar to At4g02900: CSC1-like protein At4g02900

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02900`	Calcium-permeable channel involved in plant stomatal immunity.	No verified direct reference in this release
`At3g21620`	Acts as an osmosensitive calcium-permeable cation channel.	No verified direct reference in this release
`At4g22120`	Acts as an osmosensitive calcium-permeable cation channel.	OSCA/TMEM63 are an Evolutionarily Conserved Family of Mechanically Activated Ion Channels.2018 · DOI: 10.7554/elife.41844 Structure-guided mutagenesis of OSCAs reveals differential activation to mechanical stimuli.2024 · DOI: 10.7554/elife.93147
`At4g04340`	May act as a hyperosmolarity-gated nonselective cation channel permeable to Ca²⁺.	OSCA1 mediates osmotic-stress-evoked Ca2+ increases vital for osmosensing in Arabidopsis.2014 · DOI: 10.1038/nature13593 OSCA/TMEM63 are an Evolutionarily Conserved Family of Mechanically Activated Ion Channels.2018 · DOI: 10.7554/elife.41844
`At1g11960`	Calcium-permeable channel that plays a key role in plant stomatal immunity.	The calcium-permeable channel OSCA1.3 regulates plant stomatal immunity.2020 · DOI: 10.1038/s41586-020-2702-1

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018838 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010118 stomatal movement Biological Process

GO:0045087 innate immune response Biological Process

GO:0140426 pathogen-associated molecular pattern receptor signaling pathway Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005227 calcium-activated cation channel activity Molecular Function

GO:0005262 calcium channel activity Molecular Function

KEGG gene cross-reference

ath:AT1G11960

ath:AT3G21620

ath:AT4G02900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.839

Rank 1 · TkA08G085940 · TK1151

Cytoplasm0.131

Rank 2 · TkA08G085940 · TK1151

Endoplasmic reticulum0.064

Rank 3 · TkA08G085940 · TK1151

Lysosome / Vacuole0.036

Rank 4 · TkA08G085940 · TK1151

Golgi apparatus0.036

Rank 5 · TkA08G085940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13967RSN1_TM7-181 aa

PF29236DUF852156-118 aa

PF14703PHM7_cyt202-364 aa

PF02714RSN1_7TM375-647 aa

PF13967RSN1_TM376-394 aa

PF14975DUF4512389-427 aa

PF29236DUF8521592-608 aa

PF13967RSN1_TM594-620 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G085940	`PF13967`	RSN1_TM	7	181	1e-41	142.9
TkA08G085940	`PF29236`	DUF8521	56	118	0.2	12.3
TkA08G085940	`PF14703`	PHM7_cyt	202	364	8e-45	153.9
TkA08G085940	`PF02714`	RSN1_7TM	375	647	8.3e-86	288.5
TkA08G085940	`PF13967`	RSN1_TM	376	394	1e-41	142.9
TkA08G085940	`PF14975`	DUF4512	389	427	0.29	12.5
TkA08G085940	`PF29236`	DUF8521	592	608	0.2	12.3
TkA08G085940	`PF13967`	RSN1_TM	594	620	1e-41	142.9
TkA08G085940	`PF29236`	DUF8521	656	691	0.2	12.3
TkA08G085940	`PF14975`	DUF4512	660	746	0.29	12.5
TkA08G085940	`PF29236`	DUF8521	709	733	0.2	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SY14`	Arabidopsis thaliana	sp\|Q9SY14\|OSC17_ARATH Hyperosmolality-gated Ca2+ permeable channel 1.7	69.400%	Swiss-Prot	High
`Q9LVE4`	Arabidopsis thaliana	sp\|Q9LVE4\|OSC15_ARATH Hyperosmolality-gated Ca2+ permeable channel 1.5	65.900%	Swiss-Prot	High
`Q5XEZ5`	Arabidopsis thaliana	sp\|Q5XEZ5\|OSC12_ARATH Hyperosmolality-gated Ca2+ permeable channel 1.2	65.000%	Swiss-Prot	High
`Q9XEA1`	Arabidopsis thaliana	sp\|Q9XEA1\|OSC11_ARATH Hyperosmolality-gated Ca2+ permeable channel 1.1	64.800%	Swiss-Prot	High
`B5TYT3`	Arabidopsis thaliana	sp\|B5TYT3\|OSC13_ARATH Hyperosmolality-gated Ca2+ permeable channel 1.3	64.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card