TkA08G080790 | RubberDandelionOmics

Gene overview

TkA08G080790

Reference: TK1151 Chr: Chr08 Coordinates: 20758387-20760814 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1929 bp · TkA08G080790|TK1151|cDNA

ATACTCATGGTTACGTTCAACCCACAGAAGGTGGAGTCGAAATTTCGAGCTATAGAAAGATGCCAAAACGTGGAAGAATATACCATTGAAGATACTTACACTATTTGTTGCATATAAATTCTTACACCAGCGCCCGCAAATCTTCCATCACCTTCTGGATCATCTTCAGAATAACAGAAAGAATTTGACGAAAACGAAGGAGAACGAGATCTGTTGCAGATTTAGGGGTTTTGGAAACCTCAGAAGTTTTCAGAAACAAT...

CDS

Download CDS FASTA

1596 bp · TkA08G080790|TK1151|CDS

ATGTCGACAGCTGGAAACTTGAAAGTTCTGAATGCTCTTGACGGCGCCAAAACTCAATGGTACCATTTCACCGCCATAGTAATCGCCGGAATGGGATTTTTCACCGACGCCTACGACCTCTTCTGTATTTCACTAGTCACCAAAATGCTAGGCCGCATATACTACACAAAACCAGGCGCACCAAAACCAGGAAGCTTACCACCACATGTATCCGCCATGGTCAACGGTGTAGCCCTCTCTGGAACCCTCGCCGGTCAACT...

Protein

Download Protein FASTA

531 aa · TkA08G080790|TK1151|PROTEIN

MSTAGNLKVLNALDGAKTQWYHFTAIVIAGMGFFTDAYDLFCISLVTKMLGRIYYTKPGAPKPGSLPPHVSAMVNGVALSGTLAGQLFFGWLGDKLGRKKVYGITLMLMCLCSIASGLSFGSSPKTVLTTLCFFRFWLGFGIGGDYPLSATIMSEYSNKKTRGGFIAAVFAMQGFGILGGGVFAIIISSVFNSAYGAPSYEIDPVKSTVPEADYVWRIILMAGALPALLTFYSRSKMPETARYTALVAKNTTKANADMSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G080790`
TK1151 ID	TkA08G080790
OH-1004 ID	LXL04_000947
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	85.500
Protein coverage (%)	TK1151 98.870 / OH-1004 98.677 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G080790

Location Chr08:20758387-20760814 (-)

Description Similar to PHT1-4: Inorganic phosphate transporter 1-4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g54700`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At2g38940`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release
`At5g43370`	High-affinity transporter for external inorganic phosphate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000947 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0080187 floral organ senescence Biological Process

GO:1901684 arsenate ion transmembrane transport Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G38940

ath:AT3G54700

ath:AT5G43350

ath:AT5G43360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.553

Rank 1 · TkA08G080790 · TK1151

Lysosome / Vacuole0.158

Rank 2 · TkA08G080790 · TK1151

Cytoplasm0.157

Rank 3 · TkA08G080790 · TK1151

Endoplasmic reticulum0.110

Rank 4 · TkA08G080790 · TK1151

Golgi apparatus0.075

Rank 5 · TkA08G080790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083Sugar_tr27-519 aa

PF07690MFS_167-461 aa

PF06779MFS_467-194 aa

PF06749DUF1218106-162 aa

PF07690MFS_1370-513 aa

PF06749DUF1218383-396 aa

PF06779MFS_4400-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G080790	`PF00083`	Sugar_tr	27	519	1.2e-49	170.1
TkA08G080790	`PF07690`	MFS_1	67	461	1.9e-26	93.6
TkA08G080790	`PF06779`	MFS_4	67	194	0.0026	17.9
TkA08G080790	`PF06749`	DUF1218	106	162	0.76	11.0
TkA08G080790	`PF07690`	MFS_1	370	513	1.9e-26	93.6
TkA08G080790	`PF06749`	DUF1218	383	396	0.76	11.0
TkA08G080790	`PF06779`	MFS_4	400	424	0.0026	17.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q494P0`	Arabidopsis thaliana	sp\|Q494P0\|PHT17_ARATH Probable inorganic phosphate transporter 1-7	80.000%	Swiss-Prot	High
`Q96303`	Arabidopsis thaliana	sp\|Q96303\|PHT14_ARATH Inorganic phosphate transporter 1-4	78.300%	Swiss-Prot	High
`Q96243`	Arabidopsis thaliana	sp\|Q96243\|PHT12_ARATH Probable inorganic phosphate transporter 1-2	75.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card