TkA08G080170 | RubberDandelionOmics

Gene overview

TkA08G080170

Reference: TK1151 Chr: Chr08 Coordinates: 20574199-20577387 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1021 bp · TkA08G080170|TK1151|cDNA

AGAATGTTGTATTTTTTCAACAAAACATAATTTGTTTTCTTTCCTTTTTTTTTTTTGCATAATGATAATGTGTGTTGCCATGTTTGTTTATTTGATATCAACTACTTGCAAAACAATAAAGGTCAACGGCGTTTCCACCATACTATTATTATTAAAAAAAGTATAAATGATTTTCTGGGATTTTCCGAATCGAACCTTATCAAACCCTTGATCAGAACTCAGAAGACAGGATTGTTTTTGTGTTAGATTTATCGTCCGAT...

CDS

Download CDS FASTA

687 bp · TkA08G080170|TK1151|CDS

ATGAACCTTTTCAAGAAGAAACCCACCCCCAAAGAAGCACTTCGCGAGAGTAAACGAGAAATGGCCAATGCCACTAGAGGTATAGAGAGGGAAATCACAACATTGCAATTAGAGGAAAAGAAGCTTGTTGCTGAGATAAAAAGAACAGCTAAAACAGGAAATGAGGCAGCTACAAAGATATTAGCACGCCAATTGGTGAGGCTTAGACAACAGATAGCCAACCTACAAAGTAGTCGGGCTCAAATGAGAGGAATTGCAAC...

Protein

Download Protein FASTA

228 aa · TkA08G080170|TK1151|PROTEIN

MNLFKKKPTPKEALRESKREMANATRGIEREITTLQLEEKKLVAEIKRTAKTGNEAATKILARQLVRLRQQIANLQSSRAQMRGIATHTQALAAHSSVAVGMKGATKAMSAMNKEMAPAKQMKVMQDFQKQSAQMDMTTEMMSDAIDDVLDDDEAEDETDDLTNQVLDEIGVDVASQLSSAPKGKIAGKNKNTEDASSSGIDELEKRLAALRETQSFEEGLHDHHLLK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G080170`
TK1151 ID	TkA08G080170
OH-1004 ID	LXL04_018734
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G080170

Location Chr08:20574199-20577387 (+)

Description Similar to VPS2.3: Vacuolar protein sorting-associated protein 2 homolog 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g03950`	Component of the ESCRT-III complex, which is required for multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release
`At5g44560`	Component of the ESCRT-III complex, which is required for multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018734 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015031 protein transport Biological Process

GO:0032509 endosome transport via multivesicular body sorting pathway Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

GO:0070676 intralumenal vesicle formation Biological Process

GO:0000815 ESCRT III complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005770 late endosome Cellular Component

GO:0005771 multivesicular body Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031902 late endosome membrane Cellular Component

KEGG gene cross-reference

ath:AT1G03950

ath:AT2G06530

ath:AT5G44560

ddi:DDB_G0292400

dre:405840

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.857

Rank 1 · TkA08G080170 · TK1151

Nucleus0.286

Rank 2 · TkA08G080170 · TK1151

Mitochondrion0.062

Rank 3 · TkA08G080170 · TK1151

Endoplasmic reticulum0.055

Rank 4 · TkA08G080170 · TK1151

Cell membrane0.053

Rank 5 · TkA08G080170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25600TRIM_CC11-88 aa

PF03357Snf716-185 aa

PF11068YlqD16-86 aa

PF26091PWI_CCDC4316-39 aa

PF06657Cep57_MT_bd17-72 aa

PF14988DUF451519-137 aa

PF27549HI_1622_C19-40 aa

PF00485PRK23-95 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G080170	`PF25600`	TRIM_CC	11	88	0.59	10.7
TkA08G080170	`PF03357`	Snf7	16	185	5.8e-41	140.7
TkA08G080170	`PF11068`	YlqD	16	86	0.006	17.6
TkA08G080170	`PF26091`	PWI_CCDC43	16	39	2.1	9.3
TkA08G080170	`PF06657`	Cep57_MT_bd	17	72	3.2	9.0
TkA08G080170	`PF14988`	DUF4515	19	137	0.5	11.0
TkA08G080170	`PF27549`	HI_1622_C	19	40	0.69	10.6
TkA08G080170	`PF00485`	PRK	23	95	0.27	11.7
TkA08G080170	`PF01544`	CorA	36	166	0.74	9.8
TkA08G080170	`PF19979`	DUF6415	41	96	0.11	13.8
TkA08G080170	`PF09278`	MerR-DNA-bind	48	84	0.026	15.8
TkA08G080170	`PF27549`	HI_1622_C	55	76	0.69	10.6
TkA08G080170	`PF11652`	FAM167	59	79	3.6	8.5
TkA08G080170	`PF00485`	PRK	108	167	0.27	11.7
TkA08G080170	`PF11068`	YlqD	112	146	0.006	17.6
TkA08G080170	`PF14988`	DUF4515	119	153	0.5	11.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q941D5`	Arabidopsis thaliana	sp\|Q941D5\|VPS2C_ARATH Vacuolar protein sorting-associated protein 2 homolog 3	77.800%	Swiss-Prot	High
`Q0WTY4`	Arabidopsis thaliana	sp\|Q0WTY4\|VPS2B_ARATH Vacuolar protein sorting-associated protein 2 homolog 2	72.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card