TkA08G076560 | RubberDandelionOmics

Gene overview

TkA08G076560

Reference: TK1151 Chr: Chr08 Coordinates: 19657542-19659134 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

988 bp · TkA08G076560|TK1151|cDNA

GTATGTGCTCTGAATCTCCATATGTAATTTCTAACAGGGAGTAGAGAACTCAAGCTTTCTCGGTTGAAGGCTGGCTTTTGGGAATCCATTAAATCTGGGTTGACAAAGAACAACTCAACACAGGTTATAGAACCACCTTCTTCTACTTCTAAAGAAGATGAAAAGGAACCTCTACCAGAAGAATTCAAACTTATTGAAAAAAACTTACCAGATGGCACAATTGAACAAATAATTTTTTCATCTGGTGGGGATGTCGACAT...

CDS

Download CDS FASTA

333 bp · TkA08G076560|TK1151|CDS

ATGGTAGCAACACTGCATTCCATAAAGAAATCAGCAACTGGAGAAGGAAGTTACTTGACAGAATTAAACGAGAAGAAGTTGATAGGAATGGCTCGTGCCACATCAGATCACGCATTCAATGCAACAATATGGGATGTTCTTCTAGATCCTACCTACCAGGGGCAAGGTTTGGGGAAGGCTTTAATTGAGAAGATTATTAGGGCTTTACTTCATAGGGACATTGGGAACATAACTATGTTTGCAGACAGTAAAGTTGTAGA...

Protein

Download Protein FASTA

110 aa · TkA08G076560|TK1151|PROTEIN

MVATLHSIKKSATGEGSYLTELNEKKLIGMARATSDHAFNATIWDVLLDPTYQGQGLGKALIEKIIRALLHRDIGNITMFADSKVVDFYRNLGFEADPKDIKSMFWYPRF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G076560`
TK1151 ID	TkA08G076560
OH-1004 ID	LXL04_000101
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	89.100
Protein coverage (%)	TK1151 100.000 / OH-1004 42.857 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G076560

Location Chr08:19657542-19659134 (+)

Description Similar to TAP2: Probable acetyltransferase TAP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32070`	Protein acetyltransferase with dual specificity triggering both N-alpha-acetylation (NTA), with a preference for alanine, serine, threonine, methionine and to a lower extent valine as substrates (can also use glycine and leucine), and epsilon-lysine acetylation (KA) of several plastid proteins.	Cloning of Arabidopsis serotonin N-acetyltransferase and its role with caffeic acid O-methyltransferase in the biosynthesis of melatonin in vitro despite their different subcellular localizations.2014 · DOI: 10.1111/jpi.12181 Melatonin Improved Anthocyanin Accumulation by Regulating Gene Expressions and Resulted in High Reactive Oxygen Species Scavenging Capacity in Cabbage.2016 · DOI: 10.3389/fpls.2016.00197 Melatonin induction and its role in high light stress tolerance in Arabidopsis thaliana.2018 · DOI: 10.1111/jpi.12504 Chloroplast Acetyltransferase NSI Is Required for State Transitions in Arabidopsis thaliana.2018 · DOI: 10.1105/tpc.18.00155 Daily rhythms of phytomelatonin signaling modulate diurnal stomatal closure via regulating reactive oxygen species dynamics in Arabidopsis.2020 · DOI: 10.1111/jpi.12640 Melatonin Represses Oil and Anthocyanin Accumulation in Seeds.2020 · DOI: 10.1104/pp.20.00117 Melatonin Regulates Chloroplast Protein Quality Control via a Mitogen-Activated Protein Kinase Signaling Pathway.2021 · DOI: 10.3390/antiox10040511 Melatonin inhibits seed germination by crosstalk with abscisic acid, gibberellin, and auxin in Arabidopsis.2021 · DOI: 10.1111/jpi.12736 CAND2/PMTR1 Is Required for Melatonin-Conferred Osmotic Stress Tolerance in Arabidopsis.2021 · DOI: 10.3390/ijms22084014 Roles of Endogenous Melatonin in Resistance to Botrytis cinerea Infection in an Arabidopsis Model.2021 · DOI: 10.3389/fpls.2021.683228 H2S aids osmotic stress resistance by S-sulfhydration of melatonin production-related enzymes in Arabidopsis thaliana.2022 · DOI: 10.1007/s00299-021-02813-2

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Y5T7`	Catalyzes the N-acetylation of serotonin into N-acetylserotonin, the penultimate step in the synthesis of melatonin.	No verified direct reference in this release
`Os05g0481000`	Catalyzes the N-acetylation of serotonin into N- acetylserotonin, the penultimate step in the synthesis of melatonin.	Molecular cloning of rice serotonin N-acetyltransferase, the penultimate gene in plant melatonin biosynthesis.2013 · DOI: 10.1111/jpi.12011 Cellular localization and kinetics of the rice melatonin biosynthetic enzymes SNAT and ASMT.2014 · DOI: 10.1111/jpi.12103 Cloning and characterization of the serotonin N-acetyltransferase-2 gene (SNAT2) in rice (Oryza sativa).2016 · DOI: 10.1111/jpi.12339 Overexpression of rice serotonin N-acetyltransferase 1 in transgenic rice plants confers resistance to cadmium and senescence and increases grain yield.2017 · DOI: 10.1111/jpi.12392

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000101 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0006515 protein quality control for misfolded or incompletely synthesized proteins Biological Process

GO:0006952 defense response Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009409 response to cold Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010187 negative regulation of seed germination Biological Process

GO:0010344 seed oilbody biogenesis Biological Process

GO:0010555 response to mannitol Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

KEGG gene cross-reference

ath:AT1G32070

dosa:Os05g0481000

osa:4339123

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.415

Rank 1 · TkA08G076560 · TK1151

Plastid0.165

Rank 2 · TkA08G076560 · TK1151

Nucleus0.162

Rank 3 · TkA08G076560 · TK1151

Peroxisome0.097

Rank 4 · TkA08G076560 · TK1151

Mitochondrion0.082

Rank 5 · TkA08G076560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00583Acetyltransf_114-94 aa

PF13673Acetyltransf_1019-97 aa

PF12746GNAT_acetyltran22-95 aa

PF13508Acetyltransf_723-95 aa

PF14542Acetyltransf_CG40-69 aa

PF08445FR4741-97 aa

PF13527Acetyltransf_942-95 aa

PF10343Q_salvage71-93 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G076560	`PF00583`	Acetyltransf_1	14	94	8.2e-14	52.6
TkA08G076560	`PF13673`	Acetyltransf_10	19	97	2.9e-11	44.2
TkA08G076560	`PF12746`	GNAT_acetyltran	22	95	0.095	13.0
TkA08G076560	`PF13508`	Acetyltransf_7	23	95	1.4e-11	45.3
TkA08G076560	`PF14542`	Acetyltransf_CG	40	69	0.062	14.1
TkA08G076560	`PF08445`	FR47	41	97	0.00015	22.4
TkA08G076560	`PF13527`	Acetyltransf_9	42	95	0.016	15.9
TkA08G076560	`PF10343`	Q_salvage	71	93	0.2	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7X9V3`	Arabidopsis thaliana	sp\|Q7X9V3\|GNAT2_ARATH GCN5-related N-acetyltransferase 2, chloroplastic	73.500%	Swiss-Prot	High
`A2Y5T7`	Oryza sativa subsp. indica	sp\|A2Y5T7\|SNAT1_ORYSI Serotonin N-acetyltransferase 1, chloroplastic	72.700%	Swiss-Prot	High
`Q5KQI6`	Oryza sativa subsp. japonica	sp\|Q5KQI6\|SNAT1_ORYSJ Serotonin N-acetyltransferase 1, chloroplastic	72.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card