TkA08G072430 | RubberDandelionOmics

Gene overview

TkA08G072430

Reference: TK1151 Chr: Chr08 Coordinates: 18682890-18690427 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3436 bp · TkA08G072430|TK1151|cDNA

GGAAACCCGACGTACACGTGGCGAGATTTGACCGACTTCGTATAAAACCGAAGACGTCGCGGATCTTCTCTCGGGTTCACTTCTCAACCGCGAACAGAGAAATCGTGCCTGGCTTTTGACTGTGTGAGCGAGAAACGAGAGATGGATTTGTTACCGGCGGAGACGTCATCGGAGATAGTGAAGAAGCACAGATTTAGGTCACTGAAAATGGTAGACTTGAATTATGAAGAAGTTTTATCGGATGTTCCTTACGGTGCGGA...

CDS

Download CDS FASTA

3009 bp · TkA08G072430|TK1151|CDS

ATGGATTTGTTACCGGCGGAGACGTCATCGGAGATAGTGAAGAAGCACAGATTTAGGTCACTGAAAATGGTAGACTTGAATTATGAAGAAGTTTTATCGGATGTTCCTTACGGTGCGGACTACGGCAAACTCGACAATGGACTCCGTTACTATGTGCGATTGAATTCGAAGCCTAAAATGAGAGCTGCGCTCGCACTCGCCGTGAGAGTCGGTTCAGTTCTTGAAGAGGAAGAAGAACGAGGAGTTGCTCACATTGTTGA...

Protein

Download Protein FASTA

1002 aa · TkA08G072430|TK1151|PROTEIN

MDLLPAETSSEIVKKHRFRSLKMVDLNYEEVLSDVPYGADYGKLDNGLRYYVRLNSKPKMRAALALAVRVGSVLEEEEERGVAHIVEHLAFSATKKYTNHDIVKFLESIGAEFGACQNAVTSSDETVYELFVPIDKPELLSQAISVLAEFSSDIRVSQEDLEKERGAVMEEYRANRNASGRMQDAHWLLMMEGSKYAERLPIGLEKVIRTVSPETVKRFYTKWYHLQNMAVIAVGDFSDTKSVVELIKTHFGGKVSANDY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G072430`
TK1151 ID	TkA08G072430
OH-1004 ID	LXL04_018620
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G072430

Location Chr08:18682890-18690427 (+)

Description Similar to At5g56730: Zinc protease PQQL-like

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56730`	Zinc protease PQQL-like.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8B0E2`	Cleaves presequences (transit peptides) from chloroplastic protein precursors.	No verified direct reference in this release
`Os06g0625400`	Cleaves presequences (transit peptides) from chloroplastic protein precursors.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018620 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016485 protein processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004222 metalloendopeptidase activity Molecular Function

GO:0008233 peptidase activity Molecular Function

GO:0008237 metallopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G42390

ecj:JW1489

eco:b1494

hin:HI_1368

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.377

Rank 1 · TkA08G072430 · TK1151

Cytoplasm0.281

Rank 2 · TkA08G072430 · TK1151

Plastid0.147

Rank 3 · TkA08G072430 · TK1151

Nucleus0.125

Rank 4 · TkA08G072430 · TK1151

Peroxisome0.122

Rank 5 · TkA08G072430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00675Peptidase_M1655-176 aa

PF05193Peptidase_M16_C211-392 aa

PF17568DUF5474332-364 aa

PF26195Ig_SMCHD1_2nd430-485 aa

PF17568DUF5474517-537 aa

PF05193Peptidase_M16_C698-880 aa

PF17568DUF5474760-786 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G072430	`PF00675`	Peptidase_M16	55	176	6.8e-25	88.4
TkA08G072430	`PF05193`	Peptidase_M16_C	211	392	1.6e-31	110.3
TkA08G072430	`PF17568`	DUF5474	332	364	0.082	13.7
TkA08G072430	`PF26195`	Ig_SMCHD1_2nd	430	485	0.28	11.9
TkA08G072430	`PF17568`	DUF5474	517	537	0.082	13.7
TkA08G072430	`PF05193`	Peptidase_M16_C	698	880	1.6e-31	110.3
TkA08G072430	`PF17568`	DUF5474	760	786	0.082	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FJT9`	Arabidopsis thaliana	sp\|Q9FJT9\|PQQL_ARATH Zinc protease PQQL-like	69.200%	Swiss-Prot	High
`B8B0E2`	Oryza sativa subsp. indica	sp\|B8B0E2\|SPP_ORYSI Stromal processing peptidase, chloroplastic	24.600%	Swiss-Prot	Low
`Q69TY5`	Oryza sativa subsp. japonica	sp\|Q69TY5\|SPP_ORYSJ Stromal processing peptidase, chloroplastic	24.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card