TkA08G072110 | RubberDandelionOmics

Gene overview

TkA08G072110

Reference: TK1151 Chr: Chr08 Coordinates: 18582723-18585952 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2603 bp · TkA08G072110|TK1151|cDNA

AGACAGATAAAGGTAATGATATACACAACCAAACATTTTAGATCAAATGCTATATTTTTATGGTCACTAGTTATAAATGTAATGAGTTTTGACTACTATAGTACACTATTAGCTTCAACATTTTATAGCATATATCTAGTTTTTTAAAGATAAATGAATTTGGAGATTATAGAAAATGATTTTGAAATGTACAAAACTAATCAAAGTGTTTTCAATATTATTTTAATGATTAAATGTTTATATCAAAGATGATTTTAAAA...

CDS

Download CDS FASTA

888 bp · TkA08G072110|TK1151|CDS

ATGTTAAAAATGGCTAATCGCTTTCCAATCATTCTACACAACAGGCTCCCAATTTCGGCGGGTGTTCATAACAGTGCTTCAGTTTCTAGTTTTAGTATCGCTTCTTGCGCTCAATTTTCCAGAACACTAAAGAGGAGTAAGAATCTAAGTAGCTATCGAGTACCTCGCCGACTTGTGTTCGGAATCGGAGTTTCATTTTGGGCTCAATTCATGAACATGGCTGGGAATTCTAGCACCAGTTCTATCATCGCATCAGCTAG...

Protein

Download Protein FASTA

295 aa · TkA08G072110|TK1151|PROTEIN

MLKMANRFPIILHNRLPISAGVHNSASVSSFSIASCAQFSRTLKRSKNLSSYRVPRRLVFGIGVSFWAQFMNMAGNSSTSSIIASARTKGSVDQILENVQWPVQFPFKEEDFQRFDESSDLVFYQAPRFVTHIDDPAIAALTNYYKEAFPPRYKQERIAGMGLNEEELKANKVLTEYVVQDLNTNPKLPFADNSFDVITNVVSVDYLTKPIEVFKEMHRVLKPGGKAIMSFSNRCFFTKAISIWTSTGDADHIMIVGAYF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G072110`
TK1151 ID	TkA08G072110
OH-1004 ID	LXL04_018611
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G072110`
Location	Chr08:18582723-18585952 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018611` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009234 menaquinone biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:0008168 methyltransferase activity Molecular Function GO:0043770 demethylmenaquinone methyltransferase activity Molecular Function
KEGG gene cross-reference	bca:BCE_1640 bcb:BCB4264_A1569 bce:BC1513 bcg:BCG9842_B3776 btk:BT9727_1395 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.955

Rank 1 · TkA08G072110 · TK1151

Mitochondrion0.057

Rank 2 · TkA08G072110 · TK1151

Cytoplasm0.020

Rank 3 · TkA08G072110 · TK1151

Nucleus0.019

Rank 4 · TkA08G072110 · TK1151

Cell membrane0.012

Rank 5 · TkA08G072110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13649Methyltransf_2561-140 aa

PF08242Methyltransf_1279-145 aa

PF08241Methyltransf_1182-138 aa

PF21079GDH_HM2138-157 aa

PF28712PTAC10_helical151-168 aa

PF07021MetW157-243 aa

PF08241Methyltransf_11158-228 aa

PF13649Methyltransf_25166-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G072110	`PF13649`	Methyltransf_25	61	140	1.6e-09	39.1
TkA08G072110	`PF08242`	Methyltransf_12	79	145	5.8e-06	27.7
TkA08G072110	`PF08241`	Methyltransf_11	82	138	3e-14	54.1
TkA08G072110	`PF21079`	GDH_HM2	138	157	0.12	13.1
TkA08G072110	`PF28712`	PTAC10_helical	151	168	0.086	13.5
TkA08G072110	`PF07021`	MetW	157	243	0.0036	17.7
TkA08G072110	`PF08241`	Methyltransf_11	158	228	3e-14	54.1
TkA08G072110	`PF13649`	Methyltransf_25	166	225	1.6e-09	39.1
TkA08G072110	`PF08242`	Methyltransf_12	178	226	5.8e-06	27.7
TkA08G072110	`PF13489`	Methyltransf_23	178	248	0.00027	21.4
TkA08G072110	`PF01209`	Ubie_methyltran	179	233	1.4e-06	28.5
TkA08G072110	`PF13847`	Methyltransf_31	179	232	3.5e-06	27.6
TkA08G072110	`PF05148`	Methyltransf_8	186	227	0.064	13.8
TkA08G072110	`PF03141`	Methyltransf_29	186	230	0.1	11.9
TkA08G072110	`PF20922`	Anamorsin_N	189	229	0.025	15.0
TkA08G072110	`PF01555`	N6_N4_Mtase	205	237	0.18	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card