TkA08G068780 | RubberDandelionOmics

Gene overview

TkA08G068780

Reference: TK1151 Chr: Chr08 Coordinates: 17697949-17699431 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1409 bp · TkA08G068780|TK1151|cDNA

AAAAAAGTGGGGCACTCGGTTTTACGAAACCAAAACCAGACAAAAAAGAAGAAGAATCACCAACAAAACAACCTCAATAATTTGAAGTCGAGGTAGTATACAATGGGCAGTGGGCTAATTCCACCAACTCCACCAATCACAATTCGTGTTTTCCCAACCTCTCCCTATAAAGGATTTGTAAATCGGTTGTACCCTGAATGTGATACAGACATGAGTGACAAGAGAAAACGTCCGGTGACCGGAAAGATCGTCACCTCCGA...

CDS

Download CDS FASTA

717 bp · TkA08G068780|TK1151|CDS

ATGGGCAGTGGGCTAATTCCACCAACTCCACCAATCACAATTCGTGTTTTCCCAACCTCTCCCTATAAAGGATTTGTAAATCGGTTGTACCCTGAATGTGATACAGACATGAGTGACAAGAGAAAACGTCCGGTGACCGGAAAGATCGTCACCTCCGAGGTACAATCAGGGTTTCCGGAGGTTTGTACCAGTCCGACGACTCCATTGGAGTTCAAAGTTTTGTCGCCTACAGGCATAATAAAGTGTGAGATGGGTGGGAA...

Protein

Download Protein FASTA

238 aa · TkA08G068780|TK1151|PROTEIN

MGSGLIPPTPPITIRVFPTSPYKGFVNRLYPECDTDMSDKRKRPVTGKIVTSEVQSGFPEVCTSPTTPLEFKVLSPTGIIKCEMGGNGIGIGLGIVAALEKSNECIPAKKSSFRCRKPIGNESGEECTRNWKPIEVREKVSIFDISPAKFSDGDVYKCIASDFLSSCHLCKKRLHGKDIYMYRGDKAFCSPECRSRQIGKDERLEKHCSKQASSSSSSSSSSSNVTSPYVLATGIFAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G068780`
TK1151 ID	TkA08G068780
OH-1004 ID	LXL04_018573
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.100
Protein coverage (%)	TK1151 88.235 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G068780

Location Chr08:17697949-17699431 (+)

Description Similar to FLZ13: FCS-Like Zinc finger 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g74940`	May act as an adapter to facilitate the interaction of SnRK1 complex with effector proteins, conferring tissue- and stimulus-type specific differences in the SnRK1 regulation pathway.	No verified direct reference in this release
`At1g19200`	May act as an adapter to facilitate the interaction of SnRK1 complex with effector proteins, conferring tissue- and stimulus-type specific differences in the SnRK1 regulation pathway.	No verified direct reference in this release
`At5g20700`	May act as an adapter to facilitate the interaction of SnRK1 complex with effector proteins, conferring tissue- and stimulus-type specific differences in the SnRK1 regulation pathway.	No verified direct reference in this release
`At1g22160`	May act as an adapter to facilitate the interaction of SnRK1 complex with effector proteins, conferring tissue- and stimulus-type specific differences in the SnRK1 regulation pathway.	No verified direct reference in this release
`At1g78020`	May act as an adapter to facilitate the interaction of SnRK1 complex with effector proteins, conferring tissue- and stimulus-type specific differences in the SnRK1 regulation pathway.	FCS-like zinc finger 6 and 10 repress SnRK1 signalling in Arabidopsis.2018 · DOI: 10.1111/tpj.13854

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018573 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0042594 response to starvation Biological Process

GO:0071368 cellular response to cytokinin stimulus Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0090351 seedling development Biological Process

GO:1902074 response to salt Biological Process

GO:1905582 response to mannose Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G19200

ath:AT1G22160

ath:AT1G74940

ath:AT1G78020

ath:AT5G20700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.907

Rank 1 · TkA08G068780 · TK1151

Cytoplasm0.176

Rank 2 · TkA08G068780 · TK1151

Cell membrane0.039

Rank 3 · TkA08G068780 · TK1151

Endoplasmic reticulum0.023

Rank 4 · TkA08G068780 · TK1151

Mitochondrion0.012

Rank 5 · TkA08G068780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04570zf-FLZ113-121 aa

PF22926C1-like_CT114-119 aa

PF10367zf-Vps39_C115-121 aa

PF04570zf-FLZ161-203 aa

PF10367zf-Vps39_C163-182 aa

PF22926C1-like_CT167-193 aa

PF15761IMUP184-223 aa

PF10500SR-25195-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G068780	`PF04570`	zf-FLZ	113	121	3e-21	75.4
TkA08G068780	`PF22926`	C1-like_CT	114	119	0.93	10.2
TkA08G068780	`PF10367`	zf-Vps39_C	115	121	0.1	12.9
TkA08G068780	`PF04570`	zf-FLZ	161	203	3e-21	75.4
TkA08G068780	`PF10367`	zf-Vps39_C	163	182	0.1	12.9
TkA08G068780	`PF22926`	C1-like_CT	167	193	0.93	10.2
TkA08G068780	`PF15761`	IMUP	184	223	0.24	12.9
TkA08G068780	`PF10500`	SR-25	195	224	0.14	12.4
TkA08G068780	`PF30675`	FAM133	196	224	1.4	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GRN0`	Arabidopsis thaliana	sp\|Q8GRN0\|FLZ13_ARATH FCS-Like Zinc finger 13	36.000%	Swiss-Prot	Medium
`F4IE21`	Arabidopsis thaliana	sp\|F4IE21\|FLZ12_ARATH FCS-Like Zinc finger 12	35.400%	Swiss-Prot	Medium
`Q8GYX2`	Arabidopsis thaliana	sp\|Q8GYX2\|FLZ14_ARATH FCS-Like Zinc finger 14	39.400%	Swiss-Prot	Low
`Q8VY80`	Arabidopsis thaliana	sp\|Q8VY80\|FLZ5_ARATH FCS-Like Zinc finger 5	68.800%	Swiss-Prot	Low
`Q9SGZ8`	Arabidopsis thaliana	sp\|Q9SGZ8\|FLZ6_ARATH FCS-Like Zinc finger 6	64.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card