TkA08G068540 | RubberDandelionOmics

Gene overview

TkA08G068540

Reference: TK1151 Chr: Chr08 Coordinates: 17643880-17646730 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1136 bp · TkA08G068540|TK1151|cDNA

AAAAGAGTGACGCCTAATTTCATACTTCCATCGCTGATATCATCCCGCTCGATCTCGCTCGATAGTTGCGCAAAAAATCAACTCCCGCTCACGATCAATCGCCTCTAACTAGGGTTTTTGGTTTAGGCACTATGAAGAATTTCGAAGTTCAAGGGTTTCGATTTTAATTGAAATCGGTTGATTGGTGCTCACAATGCCCCGATATTGAAGGTGTTACTGGAATCTACGCATTCAACTAATTATGAGCCAATGAGCATGGT...

CDS

Download CDS FASTA

531 bp · TkA08G068540|TK1151|CDS

ATGTTGAGAAAGCATGGTGTTGTTGGCAAGTTTGTTGAGTTTTTCGGTGAGGGTATGAGTGTGCTGTCATTGGCTGATAGGGCAACTATTGCAAATATGTCACCCGAGTATGGTGCAACCATGGGCTTCTTCCCTGTAGACCATGTCACTTTACAGTACCTTAAATTAACCGGAAGAAGTGATGAAACTGTGGCTATGATTGAAGCATACTTGCGAGCAAACAACATGTTTGTTGATTACAGCGAGCCTCAACTAGAGAA...

Protein

Download Protein FASTA

176 aa · TkA08G068540|TK1151|PROTEIN

MLRKHGVVGKFVEFFGEGMSVLSLADRATIANMSPEYGATMGFFPVDHVTLQYLKLTGRSDETVAMIEAYLRANNMFVDYSEPQLEKAYSANLQLDLNDVEPCISGPKRPGLPNQKVENEHSIINQQLKQIIDAAMLVYTTQSGSDKRLNLMWAGTETAWKHRVWLLCVQVHERDY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G068540`
TK1151 ID	TkA08G068540
OH-1004 ID	LXL04_016303
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.400
Protein coverage (%)	TK1151 62.500 / OH-1004 11.122 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G068540

Location Chr08:17643880-17646730 (+)

Description Similar to ACO3: Aconitate hydratase 3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g05710`	Catalyzes the isomerization of citrate to isocitrate via cis- aconitate.	Selective induction and subcellular distribution of ACONITASE 3 reveal the importance of cytosolic citrate metabolism during lipid mobilization in Arabidopsis.2014 · DOI: 10.1042/bj20140430
`At4g26970`	Catalyzes the isomerization of citrate to isocitrate via cis- aconitate.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0191100`	Catalyzes the isomerization of citrate to isocitrate via cis-aconitate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016303 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006101 citrate metabolic process Biological Process

GO:0006102 isocitrate metabolic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0090351 seedling development Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G05710

ath:AT4G26970

ath:AT4G35830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.389

Rank 1 · TkA08G068540 · TK1151

Cytoplasm0.273

Rank 2 · TkA08G068540 · TK1151

Mitochondrion0.152

Rank 3 · TkA08G068540 · TK1151

Plastid0.136

Rank 4 · TkA08G068540 · TK1151

Cell membrane0.050

Rank 5 · TkA08G068540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00330Aconitase1-116 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G068540	`PF00330`	Aconitase	1	116	2.8e-37	129.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIB9`	Arabidopsis thaliana	sp\|Q9SIB9\|ACO3M_ARATH Aconitate hydratase 3, mitochondrial	88.200%	Swiss-Prot	Medium
`Q94A28`	Arabidopsis thaliana	sp\|Q94A28\|ACO2M_ARATH Aconitate hydratase 2, mitochondrial	87.300%	Swiss-Prot	Medium
`Q6YZX6`	Oryza sativa subsp. japonica	sp\|Q6YZX6\|ACOHC_ORYSJ Putative aconitate hydratase, cytoplasmic	88.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card