Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1766 bp · TkA08G066710|TK1151|cDNA
GTTTGTCAAATCCCACTATGCCAAGACAGACTCCCGAAAAGAAGCATGTTAGAACGGTTCAGATATCGTTTGTAACATTCCCAATTTCCCTAACTTCCCCGGAAATCCATCAAGAACCCTAGAATTTGACGACACTTACCCAGGAAATCGCCCGTCGAAAGCCAAATCGGAAATCTAAAGCCATGGATGGGAGTATCCTGGAATCAATCGGAGTTGAAATCATCGGCGTAATGTCTCCGGTATCAATCTGCATGCTTCTC...
1296 bp · TkA08G066710|TK1151|CDS
ATGGATGGGAGTATCCTGGAATCAATCGGAGTTGAAATCATCGGCGTAATGTCTCCGGTATCAATCTGCATGCTTCTCGTAGTCCTCATAGTCTACTCTCTCACAGCCTTCTCCTCTCCGTCCGGCGAGCCCATCCGCACCGCTGCTAATCTCGTCTACCTCGAAACGCCAACGGATTCCACAACCGAGAAGATCGAAGGCTCGTTACTCAATGCTCTCGTCTTCGTGATCCTCATCGCCGCTGTAACCTTCCTCCTTGT...
Protein
Download Protein FASTA431 aa · TkA08G066710|TK1151|PROTEIN
MDGSILESIGVEIIGVMSPVSICMLLVVLIVYSLTAFSSPSGEPIRTAANLVYLETPTDSTTEKIEGSLLNALVFVILIAAVTFLLVLLYYYNFTNFLKNYMRFSAFFVLGVMGGSIFISIIRQFSIPIDAITCLILLFNFTVVGVLSVFADGIPIPILLRQVYMVLLGIIVAAWFTNLPEWTTWTLLVALALYDLVAVLAPGGPLKILVELASSRDDELPALVYEARPTVSRNPRASSGFGLLVGGVSSDSVELEMTRH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G066710 |
|---|---|
| TK1151 ID | TkA08G066710 |
| OH-1004 ID | LXL04_018536 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.000 |
| Protein coverage (%) | TK1151 97.448 / OH-1004 99.057Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G066710 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:17171050-17173242 (-) | |||||||||
| Description | Similar to At1g08700: Presenilin-like protein At1g08700 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0001708 cell fate specification Biological Process GO:0001921 positive regulation of receptor recycling Biological Process GO:0006509 membrane protein ectodomain proteolysis Biological Process GO:0006974 DNA damage response Biological Process GO:0007155 cell adhesion Biological Process GO:0007219 Notch signaling pathway Biological Process GO:0007220 Notch receptor processing Biological Process GO:0010468 regulation of gene expression Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0010629 negative regulation of gene expression Biological Process GO:0016048 detection of temperature stimulus Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G08700 ath:AT2G29900 cel:CELE_F35H12.3 hsa:5663 pon:100173083 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01080Presenilin10-421 aaPF12216m04gp34like31-99 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G066710 | PF01080 | Presenilin | 10 | 421 | 9.5e-128 | 427.2 |
| TkA08G066710 | PF12216 | m04gp34like | 31 | 99 | 0.12 | 12.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.