TkA08G066160 | RubberDandelionOmics

Gene overview

TkA08G066160

Reference: TK1151 Chr: Chr08 Coordinates: 17022560-17025542 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2924 bp · TkA08G066160|TK1151|cDNA

TCAAGCTAAAATGTTTTTATCACGTGCCAAATTTATGTTGCCAAAAAAGACGGCAGTGAAAACAACTGACACTCACAGTAACCACCAAATGAGATCAAATAGAAACCATGAAGTGAGAAAAATACGGCCCACTAAATCCTCAAACTCCACAAATCCTCCAAAATTCGTTACAATCGAATCACATGTGTCCCAGAAAATCCGATCAATCAAACACCCAAATAAACCCCATAACCATATTCCAACGAAGAAAAAACACAACA...

CDS

Download CDS FASTA

1941 bp · TkA08G066160|TK1151|CDS

ATGTGTCCCAGAAAATCCGATCAATCAAACACCCAAATAAACCCCATAACCATATTCCAACGAAGAAAAAACACAACAACAATTGTTTATTCAACCGATTTCCATAATTTTTGTAGCCTCTCTGCCTTGGTTACAATCCAAGGCAGAGATCAAATCATGGCATTTCAAGATTTTGACCAAATTACAGAACGCCGACGACTTGAACGAAAACAGAAACTGAAACGAAGAATCATAGTCGGAGTTGTCGTCGCGGTTTTAAT...

Protein

Download Protein FASTA

646 aa · TkA08G066160|TK1151|PROTEIN

MCPRKSDQSNTQINPITIFQRRKNTTTIVYSTDFHNFCSLSALVTIQGRDQIMAFQDFDQITERRRLERKQKLKRRIIVGVVVAVLILSAAIVAFLIFLNNVHQDEADDVANVGDDDASSNTFTSSGENGNNEKKILQNQKAVKLACESTDYKETCESHLEKSLSSGKEKPSGIPQPEDLVKAAIAAASDELNNAIEETAKAVKGESAVHDVCKQVLEDAQDDFNRSRNAAMDGTASSVLDLDCWLSAVIAYQQTCIDAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G066160`
TK1151 ID	TkA08G066160
OH-1004 ID	LXL04_018522
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G066160

Location Chr08:17022560-17025542 (-)

Description Similar to PME13: Probable pectinesterase/pectinesterase inhibitor 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26450`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At4g33230`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At5g27870`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g05610`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release
`At3g06830`	Acts in the modification of cell walls via demethylesterification of cell wall pectin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018522 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042545 cell wall modification Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0048358 mucilage pectin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0016020 membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0030599 pectinesterase activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT2G26450

ath:AT3G06830

ath:AT4G33230

ath:AT5G27870

ath:AT5G49180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.389

Rank 1 · TkA08G066160 · TK1151

Extracellular0.306

Rank 2 · TkA08G066160 · TK1151

Cytoplasm0.130

Rank 3 · TkA08G066160 · TK1151

Endoplasmic reticulum0.126

Rank 4 · TkA08G066160 · TK1151

Lysosome / Vacuole0.101

Rank 5 · TkA08G066160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19865DUF633860-107 aa

PF11657Activator-TraM69-98 aa

PF13624SurA_N_374-187 aa

PF14362DUF440774-265 aa

PF23714Rv3627c_N78-109 aa

PF13623SurA_N_281-142 aa

PF04043PMEI142-286 aa

PF11657Activator-TraM176-240 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G066160	`PF19865`	DUF6338	60	107	0.22	11.8
TkA08G066160	`PF11657`	Activator-TraM	69	98	1.9	9.3
TkA08G066160	`PF13624`	SurA_N_3	74	187	0.085	13.4
TkA08G066160	`PF14362`	DUF4407	74	265	0.56	10.2
TkA08G066160	`PF23714`	Rv3627c_N	78	109	1.7	9.9
TkA08G066160	`PF13623`	SurA_N_2	81	142	0.081	13.5
TkA08G066160	`PF04043`	PMEI	142	286	7e-23	82.2
TkA08G066160	`PF11657`	Activator-TraM	176	240	1.9	9.3
TkA08G066160	`PF07007`	LprI	180	246	0.11	13.6
TkA08G066160	`PF11657`	Activator-TraM	252	280	1.9	9.3
TkA08G066160	`PF07007`	LprI	265	322	0.11	13.6
TkA08G066160	`PF23714`	Rv3627c_N	320	337	1.7	9.9
TkA08G066160	`PF01095`	Pectinesterase	333	630	1.5e-136	454.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7Y201`	Arabidopsis thaliana	sp\|Q7Y201\|PME13_ARATH Probable pectinesterase/pectinesterase inhibitor 13	50.700%	Swiss-Prot	High
`Q9SMY6`	Arabidopsis thaliana	sp\|Q9SMY6\|PME45_ARATH Putative pectinesterase/pectinesterase inhibitor 45	45.600%	Swiss-Prot	Medium
`Q3E8Z8`	Arabidopsis thaliana	sp\|Q3E8Z8\|PME28_ARATH Putative pectinesterase/pectinesterase inhibitor 28	40.800%	Swiss-Prot	Medium
`Q8GX86`	Arabidopsis thaliana	sp\|Q8GX86\|PME21_ARATH Probable pectinesterase/pectinesterase inhibitor 21	41.800%	Swiss-Prot	Medium
`Q8GXA1`	Arabidopsis thaliana	sp\|Q8GXA1\|PME23_ARATH Probable pectinesterase/pectinesterase inhibitor 23	43.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card