TkA08G062950 | RubberDandelionOmics

Gene overview

TkA08G062950

Reference: TK1151 Chr: Chr08 Coordinates: 16090682-16093218 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

989 bp · TkA08G062950|TK1151|cDNA

CTGATTTAAGATGACAGATTTATACCGCCATTGTGATTTGGGGGTATTGTTAGATATTCAAACTGGGTTTCCGGCAACCAAAAATGGCGAATCTTTTCCTGAAACAAGCAAAGCAATACTCACAGACTCGACCAGGTTATCCACAACAGCTCTTCGATTTCATCGTCTCCAAGACGCCCAACCATGACCTTGTCTGGGACGTCGGCACCGGCAGCGGTCAGGCAGCTACCTCCCTTGCGAGCATATACAAGAACGTAATC...

CDS

Download CDS FASTA

792 bp · TkA08G062950|TK1151|CDS

ATGGCGAATCTTTTCCTGAAACAAGCAAAGCAATACTCACAGACTCGACCAGGTTATCCACAACAGCTCTTCGATTTCATCGTCTCCAAGACGCCCAACCATGACCTTGTCTGGGACGTCGGCACCGGCAGCGGTCAGGCAGCTACCTCCCTTGCGAGCATATACAAGAACGTAATCGGCACAGATACAAGCAAAAAACAGCTAGAATTTGCTCCGAAACTCCCCAATGTTCGTTACGAATGTACTTCCCCCAACCTATC...

Protein

Download Protein FASTA

263 aa · TkA08G062950|TK1151|PROTEIN

MANLFLKQAKQYSQTRPGYPQQLFDFIVSKTPNHDLVWDVGTGSGQAATSLASIYKNVIGTDTSKKQLEFAPKLPNVRYECTSPNLSKPELETKIGTESSVDLVTVAQALHWFDHEIFYDQVKWILKKPNGVIAAWCYTIPEIDDEFDPIFRKFYLESKPHWDSLRGIVDDKYTSVAFPFESVDGCDHTGPFEFRSKKMMSFDEFCTYIRSWSAYQTAKVKGVELLNGGVMEEFRRAWKEDENGEKSVTYPVYLRIGKVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G062950`
TK1151 ID	TkA08G062950
OH-1004 ID	LXL04_003973
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	43.100
Protein coverage (%)	TK1151 96.198 / OH-1004 91.544 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G062950`
Location	Chr08:16090682-16093218 (+)
Description	Similar to DDB_G0268948: Putative methyltransferase DDB_G0268948
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_003973` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009813 flavonoid biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:0034198 cellular response to amino acid starvation Biological Process GO:0055088 lipid homeostasis Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0045335 phagocytic vesicle Cellular Component GO:0003729 mRNA binding Molecular Function GO:0008168 methyltransferase activity Molecular Function GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function GO:0046547 trans-aconitate 3-methyltransferase activity Molecular Function
KEGG gene cross-reference	ddi:DDB_G0268948 sce:YER175C sce:YHR209W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.771

Rank 1 · TkA08G062950 · TK1151

Nucleus0.380

Rank 2 · TkA08G062950 · TK1151

Peroxisome0.069

Rank 3 · TkA08G062950 · TK1151

Mitochondrion0.069

Rank 4 · TkA08G062950 · TK1151

Cell membrane0.031

Rank 5 · TkA08G062950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13489Methyltransf_238-29 aa

PF13489Methyltransf_2316-115 aa

PF08241Methyltransf_1118-29 aa

PF13649Methyltransf_2519-29 aa

PF13649Methyltransf_2537-127 aa

PF13847Methyltransf_3137-138 aa

PF08241Methyltransf_1139-133 aa

PF08242Methyltransf_1239-127 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G062950	`PF13489`	Methyltransf_23	8	29	0.0056	17.1
TkA08G062950	`PF13489`	Methyltransf_23	16	115	0.0056	17.1
TkA08G062950	`PF08241`	Methyltransf_11	18	29	1.6e-09	39.0
TkA08G062950	`PF13649`	Methyltransf_25	19	29	2.4e-07	32.1
TkA08G062950	`PF13649`	Methyltransf_25	37	127	2.4e-07	32.1
TkA08G062950	`PF13847`	Methyltransf_31	37	138	0.00011	22.7
TkA08G062950	`PF08241`	Methyltransf_11	39	133	1.6e-09	39.0
TkA08G062950	`PF08242`	Methyltransf_12	39	127	4e-06	28.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card