TkA08G062850 | RubberDandelionOmics

Gene overview

TkA08G062850

Reference: TK1151 Chr: Chr08 Coordinates: 16047037-16049913 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · TkA08G062850|TK1151|cDNA

GTAAAACCAAAGCCCCCTTTTTAATCACTTTCTTCTCTCTCAACGGTCGCTCCGTGTTCAACTCGCGTTTCAGCGAAATCATATAAAGAATTTTCTTCCTGAGCAGCCATCACTGAAATCGAACTTTTGATTCTCAAGTTCTAAGTATTTTGATATCATATCTGCGATCTCCGTTTTCCGATTTTGTTTGATCTCTTAAAAAAACCCGATTTGCTGTGAATTTCACCGTATTTATCTCGATTTCAAGGGATGTGTGAATT...

CDS

Download CDS FASTA

474 bp · TkA08G062850|TK1151|CDS

ATGTCGCTTTACATTGGTCGCGAGGCTTCCAAGCTCTGGAAAAGAATATGTGCAGAAACTACAACAGAAATCAACCTTCTAGTTGAGAATTGGAAGTATATTCTCGGCGGCTTAATCTGCCAGTACATTCATGGTCTAGCAGCTCGATCAGTTCATTATTTTCATCATCCAGGACCACTTCTTCAAGATTCCGGGTTCTTTCTTCTTCCTGAACTTGGGCAAGAAAGAGCATATGTCAGTGAGACTGTATTCACCTTTGT...

Protein

Download Protein FASTA

157 aa · TkA08G062850|TK1151|PROTEIN

MSLYIGREASKLWKRICAETTTEINLLVENWKYILGGLICQYIHGLAARSVHYFHHPGPLLQDSGFFLLPELGQERAYVSETVFTFVFLSFVLWTFHPFIFKSKKIYTVLIWVRVLAFLVACQFLRIITFYSTILPGPNTIVARVHGLQHCLVRIIF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G062850`
TK1151 ID	TkA08G062850
OH-1004 ID	LXL04_018464
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 88.535 / OH-1004 45.130 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G062850

Location Chr08:16047037-16049913 (+)

Description Similar to IPCS1: Phosphatidylinositol:ceramide inositolphosphotransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37940`	Catalyzes the transfer of the phosphorylinositol group from phosphatidylinositol (PI) to phytoceramide, an essential step in sphingolipid biosynthesis.	An inositolphosphorylceramide synthase is involved in regulation of plant programmed cell death associated with defense in Arabidopsis.2008 · DOI: 10.1105/tpc.108.060053
`At3g54020`	Catalyzes the transfer of the phosphorylinositol group from phosphatidylinositol (PI) to phytoceramide, an essential step in sphingolipid biosynthesis.	No verified direct reference in this release
`At2g29525`	Catalyzes the transfer of the phosphorylinositol group from phosphatidylinositol (PI) to phytoceramide, an essential step in sphingolipid biosynthesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8ACH9`	Catalyzes the transfer of the phosphorylinositol group from phosphatidylinositol (PI) to phytoceramide, an essential step in sphingolipid biosynthesis.	No verified direct reference in this release
`Os01g0850100`	Catalyzes the transfer of the phosphorylinositol group from phosphatidylinositol (PI) to phytoceramide, an essential step in sphingolipid biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018464 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0030148 sphingolipid biosynthetic process Biological Process

GO:0046513 ceramide biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0033188 sphingomyelin synthase activity Molecular Function

GO:0045140 inositol phosphoceramide synthase activity Molecular Function

GO:0047493 ceramide cholinephosphotransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G29525

ath:AT2G37940

ath:AT3G54020

dosa:Os01g0850100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.562

Rank 1 · TkA08G062850 · TK1151

Nucleus0.138

Rank 2 · TkA08G062850 · TK1151

Golgi apparatus0.117

Rank 3 · TkA08G062850 · TK1151

Cytoplasm0.113

Rank 4 · TkA08G062850 · TK1151

Mitochondrion0.098

Rank 5 · TkA08G062850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SH93`	Arabidopsis thaliana	sp\|Q9SH93\|IPCS2_ARATH Phosphatidylinositol:ceramide inositolphosphotransferase 2	81.300%	Swiss-Prot	High
`Q9M325`	Arabidopsis thaliana	sp\|Q9M325\|IPCS1_ARATH Phosphatidylinositol:ceramide inositolphosphotransferase 1	80.600%	Swiss-Prot	High
`Q56Y01`	Arabidopsis thaliana	sp\|Q56Y01\|IPCS3_ARATH Phosphatidylinositol:ceramide inositolphosphotransferase 3	64.000%	Swiss-Prot	High
`B8ACH9`	Oryza sativa subsp. indica	sp\|B8ACH9\|IPCS_ORYSI Phosphatidylinositol:ceramide inositolphosphotransferase	69.800%	Swiss-Prot	High
`Q5N7A7`	Oryza sativa subsp. japonica	sp\|Q5N7A7\|IPCS_ORYSJ Phosphatidylinositol:ceramide inositolphosphotransferase	69.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card