TkA08G055010 | RubberDandelionOmics

Gene overview

TkA08G055010

Reference: TK1151 Chr: Chr08 Coordinates: 14112470-14114693 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1638 bp · TkA08G055010|TK1151|cDNA

ATGTTGAAAATTCTTGCGAAGCCTATTATTTGTTCACATGGCGAAGTCCATCTACCAGCATTCAGGCTTGGTCAAAAATTCAAGAACAAAGAAGATGTGAAGCAGGTAAAGTGCAAGGGTGTCGTTGCTGACTTAACTCAAAGTGGGCCATGGACAAAAGTCAAACTTAACTGCAAGAAGAAAGTTGTTGCTTCTACTACTTCCACTTGCCCTTGGGTGTTGTTTATTTCAAGGAAGAATATTGAAGATGAGTGGATGGT...

CDS

Download CDS FASTA

1638 bp · TkA08G055010|TK1151|CDS

ATGTTGAAAATTCTTGCGAAGCCTATTATTTGTTCACATGGCGAAGTCCATCTACCAGCATTCAGGCTTGGTCAAAAATTCAAGAACAAAGAAGATGTGAAGCAGGTAAAGTGCAAGGGTGTCGTTGCTGACTTAACTCAAAGTGGGCCATGGACAAAAGTCAAACTTAACTGCAAGAAGAAAGTTGTTGCTTCTACTACTTCCACTTGCCCTTGGGTGTTGTTTATTTCAAGGAAGAATATTGAAGATGAGTGGATGGT...

Protein

Download Protein FASTA

545 aa · TkA08G055010|TK1151|PROTEIN

MLKILAKPIICSHGEVHLPAFRLGQKFKNKEDVKQVKCKGVVADLTQSGPWTKVKLNCKKKVVASTTSTCPWVLFISRKNIEDEWMVKTVVSDHTCAYSREIKACTAEFMGKNLIGQVERNPTIPVRALHEELQKKYEVGFSRMKAFRAKQIAQKHVFGDFQKQYALLWDYGLELKRTNVGTTFKVDVYSEPNVNSQTRMFKRVYVCLGPLKLGFKAGLRDFLGFDGCFLKGPYPGQILSAVGLDSNNGIYPLAYSIVES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G055010`
TK1151 ID	TkA08G055010
OH-1004 ID	LXL04_035874
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	92.400
Protein coverage (%)	TK1151 89.908 / OH-1004 49.763 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G055010`
Location	Chr08:14112470-14114693 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035874` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.798

Rank 1 · TkA08G055010 · TK1151

Cytoplasm0.219

Rank 2 · TkA08G055010 · TK1151

Endoplasmic reticulum0.036

Rank 3 · TkA08G055010 · TK1151

Cell membrane0.034

Rank 4 · TkA08G055010 · TK1151

Mitochondrion0.025

Rank 5 · TkA08G055010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14684Tricorn_C151-66 aa

PF10551MULE130-154 aa

PF10551MULE223-318 aa

PF00872Transposase_mut241-331 aa

PF20355DUF6650294-353 aa

PF14684Tricorn_C1304-339 aa

PF04434SWIM460-485 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G055010	`PF14684`	Tricorn_C1	51	66	0.053	14.2
TkA08G055010	`PF10551`	MULE	130	154	1.3e-20	74.3
TkA08G055010	`PF10551`	MULE	223	318	1.3e-20	74.3
TkA08G055010	`PF00872`	Transposase_mut	241	331	3.4e-07	30.2
TkA08G055010	`PF20355`	DUF6650	294	353	0.12	12.9
TkA08G055010	`PF14684`	Tricorn_C1	304	339	0.053	14.2
TkA08G055010	`PF04434`	SWIM	460	485	1.2e-07	31.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card