TkA08G048780 | RubberDandelionOmics

Gene overview

TkA08G048780

Reference: TK1151 Chr: Chr08 Coordinates: 12412962-12413399 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

438 bp · TkA08G048780|TK1151|cDNA

ATGACTCAGCGAACGGTCGAGGCATTTGAGGAATATAAACACAGGTCTTACAGACAACTTACAGAGGGTGTCGTAAAAGTTAAGGTTTCAGAAAAGGTTTTTAAATGTCCATATTGTCCCGAAAGTAAAGATTACAGTTATGAGGAGGAGTTATGTAGGCATGCATCTCGTATAGCGAGAGAATCAAAAAGTGTTGGTTTAAAAGAAAAGGCCAAACACCAGGGACTTTTGGAGTTTCTCAAGTCTGCAAACAGGATGGA...

CDS

Download CDS FASTA

438 bp · TkA08G048780|TK1151|CDS

ATGACTCAGCGAACGGTCGAGGCATTTGAGGAATATAAACACAGGTCTTACAGACAACTTACAGAGGGTGTCGTAAAAGTTAAGGTTTCAGAAAAGGTTTTTAAATGTCCATATTGTCCCGAAAGTAAAGATTACAGTTATGAGGAGGAGTTATGTAGGCATGCATCTCGTATAGCGAGAGAATCAAAAAGTGTTGGTTTAAAAGAAAAGGCCAAACACCAGGGACTTTTGGAGTTTCTCAAGTCTGCAAACAGGATGGA...

Protein

Download Protein FASTA

145 aa · TkA08G048780|TK1151|PROTEIN

MTQRTVEAFEEYKHRSYRQLTEGVVKVKVSEKVFKCPYCPESKDYSYEEELCRHASRIARESKSVGLKEKAKHQGLLEFLKSANRMDSDHMGLESLLEQMCKRSEELQSQISTKDSDMASVMKQKEMIIDNFNRGTYLFLNSLIK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G048780`
TK1151 ID	TkA08G048780
OH-1004 ID	LXL04_017810
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	83.100
Protein coverage (%)	TK1151 92.414 / OH-1004 31.628 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G048780

Location Chr08:12412962-12413399 (-)

Description Similar to FDM3: Factor of DNA methylation 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13790`	Acts in association with FDM3 and FDM5 for RNA-directed DNA methylation (RdDM).	A subgroup of SGS3-like proteins act redundantly in RNA-directed DNA methylation.2012 · DOI: 10.1093/nar/gks034

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017810 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010569 regulation of double-strand break repair via homologous recombination Biological Process

GO:0032259 methylation Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003725 double-stranded RNA binding Molecular Function

GO:0008168 methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G13790

ath:AT1G15910

ath:AT3G12550

ath:AT4G00380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.726

Rank 1 · TkA08G048780 · TK1151

Cytoplasm0.300

Rank 2 · TkA08G048780 · TK1151

Mitochondrion0.043

Rank 3 · TkA08G048780 · TK1151

Cell membrane0.039

Rank 4 · TkA08G048780 · TK1151

Golgi apparatus0.021

Rank 5 · TkA08G048780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30079Merozoite_surf_9_helical32-54 aa

PF05605zf-Di1934-56 aa

PF13894zf-C2H2_434-55 aa

PF00096zf-C2H234-55 aa

PF03470zf-XS36-76 aa

PF30882CCDC146_CC_N50-129 aa

PF00096zf-C2H2101-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G048780	`PF30079`	Merozoite_surf_9_helical	32	54	0.19	12.1
TkA08G048780	`PF05605`	zf-Di19	34	56	0.023	15.6
TkA08G048780	`PF13894`	zf-C2H2_4	34	55	0.13	13.8
TkA08G048780	`PF00096`	zf-C2H2	34	55	0.49	11.7
TkA08G048780	`PF03470`	zf-XS	36	76	5.8e-06	27.2
TkA08G048780	`PF30882`	CCDC146_CC_N	50	129	0.027	14.5
TkA08G048780	`PF00096`	zf-C2H2	101	106	0.49	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMH6`	Arabidopsis thaliana	sp\|Q9LMH6\|FDM4_ARATH Factor of DNA methylation 4	35.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card