TkA08G048130 | RubberDandelionOmics

Gene overview

TkA08G048130

Reference: TK1151 Chr: Chr08 Coordinates: 12224285-12226579 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1510 bp · TkA08G048130|TK1151|cDNA

CTTCAAGAAACGGCATATCATCCTTCCTATTCTCCCACGCCCTAACGTACCAGAATTTTCCGACCACCTCCCTGATTAACTTTCAACACCCATTCTCAATCTTTCCTTAAAAACCACAAACTTACCGATATAATGATTAAACCCACGCCACCACCCCAATCTTAAAACCTGGCAAACGGTTTTCCCTGAGAGGATTTGACCGGCCACCGCCATGGGTTGGTCATCCACAAGGGAGCCACCGATGCTTGAAATCAAGGTGC...

CDS

Download CDS FASTA

1173 bp · TkA08G048130|TK1151|CDS

ATGGGTTGGTCATCCACAAGGGAGCCACCGATGCTTGAAATCAAGGTGCAGCACCGCCGTGACACCGCCCAACTCGGCTCTTCCTCGGTGAACAACCAACCATTATCATGTCCTCGCCGTCCTTCTCCGTCTCCTGAATTCAAACCATATAAAGATTGGGATCCTTGGTTAGTGCACACCATTGTTTTCACCAACGTCCTTCTGTTCTTGATTTCCATGTTCATCAACAATTGTCCAGAACATTCCAACAAATGCATAGC...

Protein

Download Protein FASTA

390 aa · TkA08G048130|TK1151|PROTEIN

MGWSSTREPPMLEIKVQHRRDTAQLGSSSVNNQPLSCPRRPSPSPEFKPYKDWDPWLVHTIVFTNVLLFLISMFINNCPEHSNKCIAPGFLKRFAFESMKINPLLGPAPATLLKMGALEFKKTVEEREEWRIVTCMWLHAGVFHVMANMMGLVFIGSRLEQEFGFLKIGLIYELSGIGGSLLSSLFVRTSISVGASGALFGLLGGMVSELLTNWTIYANKFAALSTLLIIVLINIAVGILPHVDNYAHLGGFFTGFFLGF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G048130`
TK1151 ID	TkA08G048130
OH-1004 ID	LXL04_017820
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G048130

Location Chr08:12224285-12226579 (+)

Description Similar to RBL1: RHOMBOID-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g29050`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At3g53780`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At5g07250`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At1g63120`	Rhomboid-type serine protease that catalyzes intramembrane proteolysis.	An Arabidopsis Rhomboid homolog is an intramembrane protease in plants.2005 · DOI: 10.1016/j.febslet.2005.09.049
`At1g12750`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017820 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0004252 serine-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12750

ath:AT1G63120

ath:AT2G29050

ath:AT3G53780

ath:AT5G07250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.363

Rank 1 · TkA08G048130 · TK1151

Golgi apparatus0.272

Rank 2 · TkA08G048130 · TK1151

Cytoplasm0.245

Rank 3 · TkA08G048130 · TK1151

Cell membrane0.174

Rank 4 · TkA08G048130 · TK1151

Endoplasmic reticulum0.168

Rank 5 · TkA08G048130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01694Rhomboid127-263 aa

PF08551DUF1751127-187 aa

PF19094EMC6_arch189-242 aa

PF08551DUF1751248-261 aa

PF19094EMC6_arch290-306 aa

PF08551DUF1751301-339 aa

PF01694Rhomboid306-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G048130	`PF01694`	Rhomboid	127	263	2.3e-40	138.8
TkA08G048130	`PF08551`	DUF1751	127	187	3.9	7.5
TkA08G048130	`PF19094`	EMC6_arch	189	242	0.051	14.7
TkA08G048130	`PF08551`	DUF1751	248	261	3.9	7.5
TkA08G048130	`PF19094`	EMC6_arch	290	306	0.051	14.7
TkA08G048130	`PF08551`	DUF1751	301	339	3.9	7.5
TkA08G048130	`PF01694`	Rhomboid	306	311	2.3e-40	138.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WQX7`	Arabidopsis thaliana	sp\|Q0WQX7\|RBL1_ARATH RHOMBOID-like protein 1	63.200%	Swiss-Prot	High
`F4JBM4`	Arabidopsis thaliana	sp\|F4JBM4\|RBL4_ARATH RHOMBOID-like protein 4	48.100%	Swiss-Prot	Medium
`Q9LYP1`	Arabidopsis thaliana	sp\|Q9LYP1\|RBL3_ARATH RHOMBOID-like protein 3	57.100%	Swiss-Prot	High
`Q9CAN1`	Arabidopsis thaliana	sp\|Q9CAN1\|RBL2_ARATH RHOMBOID-like protein 2	55.600%	Swiss-Prot	High
`Q8VZ48`	Arabidopsis thaliana	sp\|Q8VZ48\|RBL6_ARATH RHOMBOID-like protein 6, mitochondrial	51.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card