RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G047470
Reference: TK1151 Chr: Chr08 Coordinates: 12055523-12056900 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

729 bp · TkA08G047470|TK1151|cDNA

ATGGCCGGAATGGGTGATGACAACACCGGAGTGGCCGGAATGGCTTCGCCGGATCTGACTCTGATGGATGGCCATGGTGGGCGGACCAAGACTTCGATCCCGGTGCATGAAGTTACCGAAGAGTCGCATAGGACGCATGGGGGCGGCGCACAATCCAATTGTGAGAAAGTTTCTGTTAGCAGTGATTTCGGTATGGCCGGAATGAGTGATGACAACACCAGAGTGGCCGGAATGGCTTCGCCGGATCGGACTCCGATGGA...

CDS

Download CDS FASTA

729 bp · TkA08G047470|TK1151|CDS

ATGGCCGGAATGGGTGATGACAACACCGGAGTGGCCGGAATGGCTTCGCCGGATCTGACTCTGATGGATGGCCATGGTGGGCGGACCAAGACTTCGATCCCGGTGCATGAAGTTACCGAAGAGTCGCATAGGACGCATGGGGGCGGCGCACAATCCAATTGTGAGAAAGTTTCTGTTAGCAGTGATTTCGGTATGGCCGGAATGAGTGATGACAACACCAGAGTGGCCGGAATGGCTTCGCCGGATCGGACTCCGATGGA...

Protein

Download Protein FASTA

242 aa · TkA08G047470|TK1151|PROTEIN

MAGMGDDNTGVAGMASPDLTLMDGHGGRTKTSIPVHEVTEESHRTHGGGAQSNCEKVSVSSDFGMAGMSDDNTRVAGMASPDRTPMDGHCGRTKTSIPVHEVTEESHRTHGGGAQSNVSPIMKSQLPVTSDTTHLCSSNWPYVGGGAPSPKPNYNSEPNTSPLILNNRVPKSSTPKSIFSGAQYRRQIKPIANTQIHTRFYHELRIIRISLSQPSEFRSQKHRKFPTHRKNALKRITRKLST

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G047470
TK1151 IDTkA08G047470
OH-1004 IDLXL04_017827
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)89.800
Protein coverage (%)TK1151 20.248 / OH-1004 6.622
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G047470
LocationChr08:12055523-12056900 (+)
DescriptionSimilar to CYP79D16: Phenylalanine N-monooxygenase CYP79D16
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017827 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0002229 defense response to oomycetes Biological Process
GO:0006569 L-tryptophan catabolic process Biological Process
GO:0009625 response to insect Biological Process
GO:0009682 induced systemic resistance Biological Process
GO:0009684 indoleacetic acid biosynthetic process Biological Process
GO:0010120 camalexin biosynthetic process Biological Process
GO:0010132 dhurrin biosynthetic process Biological Process
GO:0019756 cyanogenic glycoside biosynthetic process Biological Process
GO:0052544 defense response by callose deposition in cell wall Biological Process
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0004497 monooxygenase activity Molecular Function
KEGG gene cross-reference
ag:AAT11920
ag:AAT11921
sbi:8061413
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.468
Rank 1 · TkA08G047470 · TK1151
Nucleus0.400
Rank 2 · TkA08G047470 · TK1151
Mitochondrion0.111
Rank 3 · TkA08G047470 · TK1151
Cell membrane0.106
Rank 4 · TkA08G047470 · TK1151
Endoplasmic reticulum0.054
Rank 5 · TkA08G047470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser