TkA08G046640 | RubberDandelionOmics

Gene overview

TkA08G046640

Reference: TK1151 Chr: Chr08 Coordinates: 11864874-11867082 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1389 bp · TkA08G046640|TK1151|cDNA

TATAACATCATATTAATCAAGTTGTATATATAAATTAATATTATCATTTTTCCAAGAGATACTGATTTATTTCATATAAAAACTTTAACTAAAAATTTCATTTACACTGAAATAATCTTTTATTCAGTAAACGGAAAGTATTAAAATACTAATAATTACGTTTCTCGTGGTACTATTATTATTATTATTATTATTATTATTTTTCTAACATTATTAGCAGACTTTCAGAAACTTTGACACGTTGCAGGTTCTTCCCCATC...

CDS

Download CDS FASTA

843 bp · TkA08G046640|TK1151|CDS

ATGGAATACGAAAACGGATACCAACAACAGATCCCAACATCAAAATACGAATGCCTTCTCTTTGATGTTGATGATACCCTTTATCCTCTAAGCTCTGGGCTATCCGGACAGTGCACCAAAAACATCAGAGAGTACATGGTGAATAATCTTGGCATAGAGGAAAGTAAAGTTCCAGAAATGTGTGCTAAACTTTACAAGGATTACGGGACAACAATGGCTGGTCTTCGGGCTCTTGGTTATGATTTCGACTATGATGAGTA...

Protein

Download Protein FASTA

280 aa · TkA08G046640|TK1151|PROTEIN

MEYENGYQQQIPTSKYECLLFDVDDTLYPLSSGLSGQCTKNIREYMVNNLGIEESKVPEMCAKLYKDYGTTMAGLRALGYDFDYDEYHSIVHGKLPYENLKPDPILRTLIHSLPYRKVIFSNANEAHVAEVLHRLGLEDCFEDVICFESLNPKNQITNSDSPKSSVIGYDDVSERAIVLPASPIVCKPFENAFQQAFKMANINPHKTLFFDDSIRNIQTAKLIGLGTVFVGCSQRKKGVDYALESIHNVREALPELWESV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G046640`
TK1151 ID	TkA08G046640
OH-1004 ID	LXL04_017832
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G046640`
Location	Chr08:11864874-11867082 (+)
Description	Similar to SPAC24B11.05: Uncharacterized protein C24B11.05 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017832` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006206 pyrimidine nucleobase metabolic process Biological Process GO:0009166 nucleotide catabolic process Biological Process GO:0016036 cellular response to phosphate starvation Biological Process GO:0070328 triglyceride homeostasis Biological Process GO:0090549 response to carbon starvation Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0008252 nucleotidase activity Molecular Function GO:0008253 5'-nucleotidase activity Molecular Function GO:0052642 lysophosphatidic acid phosphatase activity Molecular Function
KEGG gene cross-reference	sce:YER037W spo:2541562 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.585

Rank 1 · TkA08G046640 · TK1151

Nucleus0.478

Rank 2 · TkA08G046640 · TK1151

Plastid0.049

Rank 3 · TkA08G046640 · TK1151

Cell membrane0.048

Rank 4 · TkA08G046640 · TK1151

Endoplasmic reticulum0.042

Rank 5 · TkA08G046640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00702Hydrolase17-224 aa

PF12689Acid_PPase19-31 aa

PF13419HAD_220-150 aa

PF12710HAD20-147 aa

PF19627ADNP_N126-209 aa

PF13419HAD_2187-230 aa

PF13242Hydrolase_like187-232 aa

PF12689Acid_PPase192-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G046640	`PF00702`	Hydrolase	17	224	1.6e-11	45.6
TkA08G046640	`PF12689`	Acid_PPase	19	31	0.01	16.4
TkA08G046640	`PF13419`	HAD_2	20	150	5.8e-08	33.7
TkA08G046640	`PF12710`	HAD	20	147	0.094	13.8
TkA08G046640	`PF19627`	ADNP_N	126	209	0.14	13.6
TkA08G046640	`PF13419`	HAD_2	187	230	5.8e-08	33.7
TkA08G046640	`PF13242`	Hydrolase_like	187	232	0.33	11.6
TkA08G046640	`PF12689`	Acid_PPase	192	230	0.01	16.4
TkA08G046640	`PF13419`	HAD_2	241	257	5.8e-08	33.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card