RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G044320
Reference: TK1151 Chr: Chr08 Coordinates: 11295905-11298658 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1787 bp · TkA08G044320|TK1151|cDNA

AGTACGGCTTATCTCTAAACAAACTAAACACCCTCTCTACACACACCACACAACACACACAACAACATACACCATGGCGCCTGGCGTAATCAACGGTGGGAGTAGCTCCGGTGGCACCGGTGAGCACTTACCAGCCAAGCTCACCTTGCAAGTGCTTGTATGCTCCATCATTGCTGCCTTCGGTGGCCTCATGTTTGGTTATGACATCGGAATTTCAGGAGGTGTGACATCTATGGACGTGTTCTTGGAGAAGTTTTTTC...

CDS

Download CDS FASTA

1536 bp · TkA08G044320|TK1151|CDS

ATGGCGCCTGGCGTAATCAACGGTGGGAGTAGCTCCGGTGGCACCGGTGAGCACTTACCAGCCAAGCTCACCTTGCAAGTGCTTGTATGCTCCATCATTGCTGCCTTCGGTGGCCTCATGTTTGGTTATGACATCGGAATTTCAGGAGGTGTGACATCTATGGACGTGTTCTTGGAGAAGTTTTTTCCACATGTATACGTAAAAAAGCACCATGCAAGAGAAGATAATTACTGTAAATTCGATGATCAATTCCTCCAGCT...

Protein

Download Protein FASTA

511 aa · TkA08G044320|TK1151|PROTEIN

MAPGVINGGSSSGGTGEHLPAKLTLQVLVCSIIAAFGGLMFGYDIGISGGVTSMDVFLEKFFPHVYVKKHHAREDNYCKFDDQFLQLFTSSLYLAAVVCSLFASKCCKRFGRKVTIQLASLFFLGGVVLTACAVNLAMLIFGRLFLGAGVGFGNQAVPLFISEIAPAKYRGGLNVCFQLLVTVGILCASVVNYFTSTHPFGWRISLGGAAIPALFLAVGSLLIVETPTSLIERGQPEEGMRTLRKIRGVQDVQKEYDEIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G044320
TK1151 IDTkA08G044320
OH-1004 IDLXL04_017871
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G044320
LocationChr08:11295905-11298658 (+)
DescriptionSimilar to STP8: Sugar transport protein 8
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g26250 Mediates an active uptake of hexoses, probably by sugar/hydrogen symport. No verified direct reference in this release
At3g05960 Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.
AtSTP6, a new pollen-specific H+-monosaccharide symporter from Arabidopsis.2003 · DOI: 10.1104/pp.012666
At1g07340 Mediates an active uptake of hexoses, probably by sugar/hydrogen symport.
A male gametophyte-specific monosaccharide transporter in Arabidopsis.1999 · DOI: 10.1046/j.1365-313x.1999.00372.x
At5g26340 Mediates an active uptake of hexoses, probably by sugar/hydrogen symport. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0218400 Mediates active uptake of hexoses by sugar:proton symport (Probable).
Molecular cloning and expression analysis of a monosaccharide transporter gene OsMST4 from rice (Oryza sativa L.).2007 · DOI: 10.1007/s11103-007-9228-x
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017871 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009414 response to water deprivation Biological Process
GO:0009555 pollen development Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0015749 monosaccharide transmembrane transport Biological Process
GO:0034219 carbohydrate transmembrane transport Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009536 plastid Cellular Component
GO:0016020 membrane Cellular Component
KEGG gene cross-reference
ath:AT1G07340
ath:AT3G05960
ath:AT5G26250
ath:AT5G26340
dosa:Os03g0218400
osa:4332079
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.848
Rank 1 · TkA08G044320 · TK1151
Cytoplasm0.114
Rank 2 · TkA08G044320 · TK1151
Endoplasmic reticulum0.043
Rank 3 · TkA08G044320 · TK1151
Mitochondrion0.037
Rank 4 · TkA08G044320 · TK1151
Lysosome / Vacuole0.031
Rank 5 · TkA08G044320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11772EpuA26-65 aa
PF00083Sugar_tr31-485 aa
PF07690MFS_180-437 aa
PF13190PDGLE94-105 aa
PF11772EpuA138-153 aa
PF13190PDGLE180-203 aa
PF13190PDGLE316-346 aa
PF07690MFS_1433-473 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G044320PF11772EpuA26651.69.2
TkA08G044320PF00083Sugar_tr314851.1e-115387.9
TkA08G044320PF07690MFS_1804372.6e-2383.3
TkA08G044320PF13190PDGLE941052.58.7
TkA08G044320PF11772EpuA1381531.69.2
TkA08G044320PF13190PDGLE1802032.58.7
TkA08G044320PF13190PDGLE3163462.58.7
TkA08G044320PF07690MFS_14334732.6e-2383.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SBA7Arabidopsis thalianasp|Q9SBA7|STP8_ARATH Sugar transport protein 866.300%Swiss-ProtHigh
Q9SFG0Arabidopsis thalianasp|Q9SFG0|STP6_ARATH Sugar transport protein 666.300%Swiss-ProtHigh
Q9LNV3Arabidopsis thalianasp|Q9LNV3|STP2_ARATH Sugar transport protein 261.800%Swiss-ProtHigh
Q94AZ2Arabidopsis thalianasp|Q94AZ2|STP13_ARATH Sugar transport protein 1356.900%Swiss-ProtHigh
Q10PW9Oryza sativa subsp. japonicasp|Q10PW9|MST4_ORYSJ Sugar transport protein MST459.200%Swiss-ProtHigh

JBrowse

View in Genome Browser