TkA08G040930 | RubberDandelionOmics

Gene overview

TkA08G040930

Reference: TK1151 Chr: Chr08 Coordinates: 10417280-10420856 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2092 bp · TkA08G040930|TK1151|cDNA

CTCACTGGTCACTTCTAATACCACCCAAATTCATCTTTTCTTCTCCCGACACCACCACAGAAAGTGTAAAAAGCACTAAGAACTCATGCTTACTATCACTTTGTTGTGTAAATTTCAGAAAAATTGACGCAAAGAGCCTTTCTTGGTTTCATAAATTTGAATACCAATCTCCAATACAGATATTCCCTCACTTTCTCGTCTCCTTTTTCACCATTCCAACAGCCATTCATTCTTCATTCTCTTTGTTTATAGTTTTTTAC...

CDS

Download CDS FASTA

1512 bp · TkA08G040930|TK1151|CDS

ATGGTTGGGAGTGGTATAGCGGAGGTGATCAGTAGCAATGGTTGTTCAAAGATGTATTCGGATATAAATTGCACATTTGATACTAATTCTTCCAAAGATCTTCAACTTCCACGTTGTTCTCTTCGTCGTTCTTCCTCAAATTCCCCGTTTTCTGGTCTTGTTATTTGTGTTACTGGTCTATCAAAAGAAGCAAGAAAACAAGTGACGGATGCAACTGAGAGATTAGGTGGTCAATTCAGTCCCCGTTTGAATCCAAAGTG...

Protein

Download Protein FASTA

503 aa · TkA08G040930|TK1151|PROTEIN

MVGSGIAEVISSNGCSKMYSDINCTFDTNSSKDLQLPRCSLRRSSSNSPFSGLVICVTGLSKEARKQVTDATERLGGQFSPRLNPKCTHLVVQNSHEHKSEYASKHGLFIVTLGWFVDSVTKNVRLNESLYEVKTLGESYMAKDDLKRISNASSCNPNSMLDNVKQSNLIQRSRLHLREHKRRSGSIFLGQTMYIDPDVTVELRNKVVEAIRDEGGLVINEWLTGQNTTHVVCEGSSVRKYISQSNNLVSPLWVLKTVKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G040930`
TK1151 ID	TkA08G040930
OH-1004 ID	LXL04_017911
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G040930`
Location	Chr08:10417280-10420856 (-)
Description	Similar to Topbp1: DNA topoisomerase 2-binding protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017911` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000076 DNA replication checkpoint signaling Biological Process GO:0000077 DNA damage checkpoint signaling Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006259 DNA metabolic process Biological Process GO:0006270 DNA replication initiation Biological Process GO:0006281 DNA repair Biological Process GO:0006302 double-strand break repair Biological Process GO:0006974 DNA damage response Biological Process GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process GO:0007131 reciprocal meiotic recombination Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0033314 mitotic DNA replication checkpoint signaling Biological Process
KEGG gene cross-reference	hsa:11073 mmu:235559 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.781

Rank 1 · TkA08G040930 · TK1151

Cytoplasm0.238

Rank 2 · TkA08G040930 · TK1151

Cell membrane0.050

Rank 3 · TkA08G040930 · TK1151

Endoplasmic reticulum0.022

Rank 4 · TkA08G040930 · TK1151

Mitochondrion0.021

Rank 5 · TkA08G040930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00533BRCT47-119 aa

PF16589BRCT_250-131 aa

PF12738PTCB-BRCT53-115 aa

PF20415DUF669981-126 aa

PF16759LIG3_BRCT85-122 aa

PF00211Guanylate_cyc128-151 aa

PF00533BRCT186-241 aa

PF16589BRCT_2187-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G040930	`PF00533`	BRCT	47	119	3.2e-16	60.0
TkA08G040930	`PF16589`	BRCT_2	50	131	3e-12	47.4
TkA08G040930	`PF12738`	PTCB-BRCT	53	115	1.4e-18	67.3
TkA08G040930	`PF20415`	DUF6699	81	126	5.8e-06	27.2
TkA08G040930	`PF16759`	LIG3_BRCT	85	122	4.4e-05	24.4
TkA08G040930	`PF00211`	Guanylate_cyc	128	151	0.17	12.2
TkA08G040930	`PF00533`	BRCT	186	241	3.2e-16	60.0
TkA08G040930	`PF16589`	BRCT_2	187	260	3e-12	47.4
TkA08G040930	`PF16759`	LIG3_BRCT	187	260	4.4e-05	24.4
TkA08G040930	`PF12738`	PTCB-BRCT	203	241	1.4e-18	67.3
TkA08G040930	`PF16589`	BRCT_2	295	312	3e-12	47.4
TkA08G040930	`PF00211`	Guanylate_cyc	411	443	0.17	12.2
TkA08G040930	`PF20415`	DUF6699	418	487	5.8e-06	27.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card