TkA08G040870 | RubberDandelionOmics

Gene overview

TkA08G040870

Reference: TK1151 Chr: Chr08 Coordinates: 10387329-10390236 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2815 bp · TkA08G040870|TK1151|cDNA

TAGCCGTTGAGAATTAATTCCCTCCCAATTTCCGCCATTATTAAATACCCACATCCAAACAGCCATACTCATAACTCATCTTTCATGTCCGTTTACTCATGGCACCTACCGGAGAACAACACCTTCTGTCCACCGAAATCGTCAACCGGGGAACTGAACCTTCTGGTTCCATTTCTTTCTCAGTCAGGGTTCGCCGGCGGCTACCCGACTTTCTCCAGTCTGTGAACCTCAAGTACGTGAAGCTTGGCTACCGGTACCTA...

CDS

Download CDS FASTA

801 bp · TkA08G040870|TK1151|CDS

ATGGCACCTACCGGAGAACAACACCTTCTGTCCACCGAAATCGTCAACCGGGGAACTGAACCTTCTGGTTCCATTTCTTTCTCAGTCAGGGTTCGCCGGCGGCTACCCGACTTTCTCCAGTCTGTGAACCTCAAGTACGTGAAGCTTGGCTACCGGTACCTAATCAACCATGGGGTTTTCTTGGCCGCTGTGCCGGTGCTGGTCCTGGTGTTTGATGCGGAGGTCGGTCGGTTTATCAGGGAAGAACTGTGGCCGAAGCT...

Protein

Download Protein FASTA

266 aa · TkA08G040870|TK1151|PROTEIN

MAPTGEQHLLSTEIVNRGTEPSGSISFSVRVRRRLPDFLQSVNLKYVKLGYRYLINHGVFLAAVPVLVLVFDAEVGRFIREELWPKLWDTTAGYDLVFVLVTVAVFIFTLSYYLFSTPRSIYLIDFACFKPDDDLKVTKEEFIELARKSGKFDEASLKFQKKILESSGIGDETYVPKTIGLPENISTMKEGRAEASMVIFGALDELFEKTGIQPNDVGVLVVNCSVFNPTPIDFGDDHQPLQDEGRHFEFQFRRGWDAAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G040870`
TK1151 ID	TkA08G040870
OH-1004 ID	LXL04_017916
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 86.842 / OH-1004 41.622 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G040870

Location Chr08:10387329-10390236 (-)

Description Similar to FDH: 3-ketoacyl-CoA synthase 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26250`	Contributes to cuticular wax and suberin biosynthesis.	No verified direct reference in this release
`At1g19440`	3-ketoacyl-CoA synthase 4.	No verified direct reference in this release
`At2g26640`	Active on both saturated and mono-unsaturated acyl chains C16 to C20.	Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases.2006 · DOI: 10.1016/j.bbrc.2006.05.162
`At2g16280`	Involved in the elongation of C22 to C24 fatty acids, which are precursors for the biosynthesis of cuticular waxes, aliphatic suberins, and membrane lipids, including sphingolipids and phospholipids.	Arabidopsis 3-ketoacyl-coenzyme a synthase9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids.2013 · DOI: 10.1104/pp.112.210450
`At1g04220`	Mediates the synthesis of VLCFAs from 22 to 26 carbons in length (e.g. C22, C24, C26).	Specific and differential inhibition of very-long-chain fatty acid elongases from Arabidopsis thaliana by different herbicides.2004 · DOI: 10.1073/pnas.0404600101 The DAISY gene from Arabidopsis encodes a fatty acid elongase condensing enzyme involved in the biosynthesis of aliphatic suberin in roots and the chalaza-micropyle region of seeds.2009 · DOI: 10.1111/j.1365-313x.2008.03674.x Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmotic stress.2009 · DOI: 10.1111/j.1365-313x.2009.03973.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017916 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0008610 lipid biosynthetic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0090627 plant epidermal cell differentiation Biological Process

GO:0160062 cutin-based cuticle development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

KEGG gene cross-reference

ath:AT1G19440

ath:AT1G68530

ath:AT2G16280

ath:AT2G26250

ath:AT2G26640

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.709

Rank 1 · TkA08G040870 · TK1151

Nucleus0.109

Rank 2 · TkA08G040870 · TK1151

Golgi apparatus0.105

Rank 3 · TkA08G040870 · TK1151

Cytoplasm0.098

Rank 4 · TkA08G040870 · TK1151

Cell membrane0.067

Rank 5 · TkA08G040870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04241DUF42342-117 aa

PF28797Microp_apicomplexa_2352-74 aa

PF28797Microp_apicomplexa_23105-118 aa

PF08392FAE1_CUT1_RppA115-231 aa

PF11464Rbsn140-156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G040870	`PF04241`	DUF423	42	117	0.29	12.1
TkA08G040870	`PF28797`	Microp_apicomplexa_23	52	74	0.34	11.3
TkA08G040870	`PF28797`	Microp_apicomplexa_23	105	118	0.34	11.3
TkA08G040870	`PF08392`	FAE1_CUT1_RppA	115	231	3.3e-40	139.0
TkA08G040870	`PF11464`	Rbsn	140	156	0.11	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q570B4`	Arabidopsis thaliana	sp\|Q570B4\|KCS10_ARATH 3-ketoacyl-CoA synthase 10	71.500%	Swiss-Prot	High
`Q9LN49`	Arabidopsis thaliana	sp\|Q9LN49\|KCS4_ARATH 3-ketoacyl-CoA synthase 4	47.600%	Swiss-Prot	Medium
`O48780`	Arabidopsis thaliana	sp\|O48780\|KCS11_ARATH 3-ketoacyl-CoA synthase 11	48.000%	Swiss-Prot	Medium
`Q9SIX1`	Arabidopsis thaliana	sp\|Q9SIX1\|KCS9_ARATH 3-ketoacyl-CoA synthase 9	46.300%	Swiss-Prot	Medium
`Q5XEP9`	Arabidopsis thaliana	sp\|Q5XEP9\|KCS2_ARATH 3-ketoacyl-CoA synthase 2	45.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card