TkA08G037750 | RubberDandelionOmics

Gene overview

TkA08G037750

Reference: TK1151 Chr: Chr08 Coordinates: 9621121-9625836 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2130 bp · TkA08G037750|TK1151|cDNA

ATTTTATATAGAATGACTTGTAACATATAATATCATTGCAAAATTGAGTAACAGTATAATATAACAATAAAAGACTATATAATTCTATCATTCACTTCTAATATATATTAGTCACTATTGTTTAATGTTAAAGTCATTATTTTTGTATAATTTTCTAAGAGTTGGAGATCCCCTGAACAATACAAAAGTATAATTCAATGATGAAAGTAACAGAGTGGTCCTTCCAAAGGAGAAATGCCATGGGCCTGTGTCTTGTCTCT...

CDS

Download CDS FASTA

1134 bp · TkA08G037750|TK1151|CDS

ATGTCATCGTGTTTAGGTTCAAGAGCTTGTGGGTTTGATATCGAGCAAATGATCAAATGGCCATGTACTAGTACTACTTCCAGTAGAACAATTTCGAATTCTTCGTCCCCATCTTCAACTTTATCAGAATCTAGCAATTCTCCGATTGCAATTTCCACTCGAAAGCCACGAGCACCACGAAAACGACCAAATCAAACTTACAATGAAGCAGCTGCGTTGCTCTTCATGGCATGTCCCAATATTTTTAGTAGCAAACACCT...

Protein

Download Protein FASTA

377 aa · TkA08G037750|TK1151|PROTEIN

MSSCLGSRACGFDIEQMIKWPCTSTTSSRTISNSSSPSSTLSESSNSPIAISTRKPRAPRKRPNQTYNEAAALLFMACPNIFSSKHLTKRTSNQLNFTKQYGDLLHEPSELILPYPVIENSGFLPRRRNSEKPCLLVEPKFQSAGEIESNCVSAELSDGGLDDFDTQSLLDEEIEQGIDSIMGESNALLENDESNDIVSTSHGYPMGLGFGARNGVKALRNSDEGNWWNFPMVDMLDITPAPPVKCEKSPVEKKKKKKKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G037750`
TK1151 ID	TkA08G037750
OH-1004 ID	LXL04_017955
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G037750

Location Chr08:9621121-9625836 (+)

Description Similar to CIA2: Protein CHLOROPLAST IMPORT APPARATUS 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57180`	Responsible for specific up-regulation of the translocon genes TOC33 and TOC75 in leaves.	CIA2 coordinately up-regulates protein import and synthesis in leaf chloroplasts.2009 · DOI: 10.1104/pp.109.137240

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017955 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009641 shade avoidance Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0045036 protein targeting to chloroplast Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G25440

ath:AT1G68520

ath:AT1G73870

ath:AT5G57180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.861

Rank 1 · TkA08G037750 · TK1151

Cytoplasm0.194

Rank 2 · TkA08G037750 · TK1151

Cell membrane0.066

Rank 3 · TkA08G037750 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA08G037750 · TK1151

Plastid0.016

Rank 5 · TkA08G037750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06203CCT254-257 aa

PF06203CCT342-367 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G037750	`PF06203`	CCT	254	257	0.023	15.4
TkA08G037750	`PF06203`	CCT	342	367	0.023	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU68`	Arabidopsis thaliana	sp\|Q9LU68\|CIA2_ARATH Protein CHLOROPLAST IMPORT APPARATUS 2	38.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card