RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G034890
Reference: TK1151 Chr: Chr08 Coordinates: 8912300-8914787 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

738 bp · TkA08G034890|TK1151|cDNA

AAACCTCAACATCCTCAATCTAATCAGGTCTTGTCTTTATTCCCAATTCCTAAAGCAGTTTCTAAAGGCCTCGAAATTTTGAGAAGAGACTTTTTTTGGGGACAGAAAGATGATAGAAAGCCAACCCCGTGGGTGAAATGGGACACTGCGTGTCAACAAAGAAAGAACGGCGGTCTTGGAATCATTGGTATTGAAGAGATGAATATATCCCTCATTGTGAAATGGTACTGGATATTCAAAAATGAAGAAAAAGCTATCTG...

CDS

Download CDS FASTA

738 bp · TkA08G034890|TK1151|CDS

AAACCTCAACATCCTCAATCTAATCAGGTCTTGTCTTTATTCCCAATTCCTAAAGCAGTTTCTAAAGGCCTCGAAATTTTGAGAAGAGACTTTTTTTGGGGACAGAAAGATGATAGAAAGCCAACCCCGTGGGTGAAATGGGACACTGCGTGTCAACAAAGAAAGAACGGCGGTCTTGGAATCATTGGTATTGAAGAGATGAATATATCCCTCATTGTGAAATGGTACTGGATATTCAAAAATGAAGAAAAAGCTATCTG...

Protein

Download Protein FASTA

245 aa · TkA08G034890|TK1151|PROTEIN

KPQHPQSNQVLSLFPIPKAVSKGLEILRRDFFWGQKDDRKPTPWVKWDTACQQRKNGGLGIIGIEEMNISLIVKWYWIFKNEEKAIWVQVIKSIRGENGGTGDKELEKMHSCAWKSILLKIRNIKPVRIGDGESTKFWEDKWSDQGILKNRFPHLYALEEENGSLVKNRIPVEVKNWSRRRSIRGGREQEEADNIKALLDRNILSDKKDVWIISVTTRFPSNLFRLVSVKFPISRKHIKREHDDI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G034890
TK1151 IDTkA08G034890
OH-1004 IDLXL04_022574
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)85.300
Protein coverage (%)TK1151 84.490 / OH-1004 18.837
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G034890
LocationChr08:8912300-8914787 (+)
DescriptionSimilar to Dynamin-related protein 5A
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022574 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000911 cytokinesis by cell plate formation Biological Process
GO:0006886 intracellular protein transport Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process
GO:0010036 response to boron-containing substance Biological Process
GO:0010051 xylem and phloem pattern formation Biological Process
GO:0010091 trichome branching Biological Process
GO:0016192 vesicle-mediated transport Biological Process
GO:0030100 regulation of endocytosis Biological Process
GO:0048480 stigma development Biological Process
GO:0048766 root hair initiation Biological Process
GO:0050832 defense response to fungus Biological Process
KEGG gene cross-reference
ath:AT3G60190
ath:AT3G61760
ath:AT5G42080
gmx:100037461
gmx:547855
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.476
Rank 1 · TkA08G034890 · TK1151
Nucleus0.400
Rank 2 · TkA08G034890 · TK1151
Cell membrane0.088
Rank 3 · TkA08G034890 · TK1151
Mitochondrion0.047
Rank 4 · TkA08G034890 · TK1151
Endoplasmic reticulum0.033
Rank 5 · TkA08G034890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser