RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G441850
Reference: TK1151 Chr: Chr07 Coordinates: 111937934-111942176 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1496 bp · TkA07G441850|TK1151|cDNA

CCAAAGTCATCAGGTCTTATCATCGGCATTTCAATCGGTTCCAGAAGAGCATCAACCATCCCCATACGCGCAAATGGTGCAGATTCATGTACAATCTTATCCGATTCATCAATCGGAACAGAAATCACAGAATCATCAACAACATCTAAACACAACAACGGCGTTTCATTTTGGTTCACCGGACATCGAAAGTCTCACGTCGTTGCCGCTTCAGGAATCCTTGAGTATTCGTACAAAGATCTACAAAAAGCGACGAGTAA...

CDS

Download CDS FASTA

1296 bp · TkA07G441850|TK1151|CDS

ATGAAACCAAAGTCATCAGGTCTTATCATCGGCATTTCAATCGGGTTAGTAATCGGAGCAATTTTAGCCATAGTTGGACTACTCTGTTTTAGGTTTCACCGCAAACGATCTCAAATCGGCAACAGCAGTTCCAGAAGAGCATCAACCATCCCCATACGCGCAAATGGTGCAGATTCATGTACAATCTTATCCGATTCATCAATCGGAACAGAAATCACAGAATCATCAACAACATCTAAACACAACAACGGCGTTTCATT...

Protein

Download Protein FASTA

431 aa · TkA07G441850|TK1151|PROTEIN

MKPKSSGLIIGISIGLVIGAILAIVGLLCFRFHRKRSQIGNSSSRRASTIPIRANGADSCTILSDSSIGTEITESSTTSKHNNGVSFWFTGHRKSHVVAASGILEYSYKDLQKATSNFTSVIGQGAFGPVYKAQMTSGETVAVKVLATDSKQGEKEFHTEVMLLGRLHHRNLVNLVGYCAEKGQHMLIYVYMSKGSLSSHLYSENRELLCWNMRVQIALDVARGLEYLHDGAVPPVIHRDIKSSNILLDQSMNARVADFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G441850
TK1151 IDTkA07G441850
OH-1004 IDLXL04_016406
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)77.900
Protein coverage (%)TK1151 98.376 / OH-1004 95.730
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G441850
LocationChr07:111937934-111942176 (-)
DescriptionSimilar to CRLK1: Calcium/calmodulin-regulated receptor-like kinase 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g54590 Required for cold tolerance, via the activation of MAP kinases activity.
Phosphorylation of Arabidopsis thaliana MEKK1 via Ca(2+) signaling as a part of the cold stress response.2013 · DOI: 10.1007/s10265-013-0576-0
At5g15730 Calcium/calmodulin-regulated receptor-like kinase 2. No verified direct reference in this release
At5g28680 Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell. No verified direct reference in this release
At3g04690 Receptor-like protein kinase that controls pollen tube behavior by directing rupture at proper timing to release the sperm cell. No verified direct reference in this release
At3g18810 Putative proline-rich receptor-like protein kinase PERK6. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_016406 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007165 signal transduction Biological Process
GO:0009409 response to cold Biological Process
GO:0009631 cold acclimation Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0010483 pollen tube reception Biological Process
GO:0031349 positive regulation of defense response Biological Process
GO:0045087 innate immune response Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:0005634 nucleus Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference
ath:AT1G20650
ath:AT3G07070
ath:AT3G24790
ath:AT5G15730
ath:AT5G54590
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.803
Rank 1 · TkA07G441850 · TK1151
Cytoplasm0.152
Rank 2 · TkA07G441850 · TK1151
Nucleus0.116
Rank 3 · TkA07G441850 · TK1151
Endoplasmic reticulum0.053
Rank 4 · TkA07G441850 · TK1151
Golgi apparatus0.029
Rank 5 · TkA07G441850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12330Haspin_kinase109-206 aa
PF07714PK_Tyr_Ser-Thr118-378 aa
PF00069Pkinase119-377 aa
PF14531Kinase-like120-167 aa
PF03109ABC1122-149 aa
PF14531Kinase-like206-290 aa
PF03109ABC1235-264 aa
PF12330Haspin_kinase238-265 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G441850PF12330Haspin_kinase1092060.06513.0
TkA07G441850PF07714PK_Tyr_Ser-Thr1183786.7e-52177.1
TkA07G441850PF00069Pkinase1193771.4e-47163.0
TkA07G441850PF14531Kinase-like1201670.05813.4
TkA07G441850PF03109ABC11221497.7e-0522.7
TkA07G441850PF14531Kinase-like2062900.05813.4
TkA07G441850PF03109ABC12352647.7e-0522.7
TkA07G441850PF12330Haspin_kinase2382650.06513.0
TkA07G441850PF23702ARM_ECM293474230.1312.5
TkA07G441850PF14531Kinase-like3704030.05813.4
TkA07G441850PF03109ABC13894207.7e-0522.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FIU5Arabidopsis thalianasp|Q9FIU5|CRLK1_ARATH Calcium/calmodulin-regulated receptor-like kinase 169.700%Swiss-ProtHigh
Q9LFV3Arabidopsis thalianasp|Q9LFV3|CRLK2_ARATH Calcium/calmodulin-regulated receptor-like kinase 254.600%Swiss-ProtHigh
Q3E8W4Arabidopsis thalianasp|Q3E8W4|ANX2_ARATH Receptor-like protein kinase ANXUR238.100%Swiss-ProtMedium
Q9SR05Arabidopsis thalianasp|Q9SR05|ANX1_ARATH Receptor-like protein kinase ANXUR138.900%Swiss-ProtMedium
Q9LS95Arabidopsis thalianasp|Q9LS95|PERK6_ARATH Putative proline-rich receptor-like protein kinase PERK642.500%Swiss-ProtMedium

JBrowse

View in Genome Browser