TkA07G441430 | RubberDandelionOmics

Gene overview

TkA07G441430

Reference: TK1151 Chr: Chr07 Coordinates: 111810192-111810791 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

600 bp · TkA07G441430|TK1151|cDNA

ATGGCTTCCTCCACCATTTTCCACCTCTACCCTTTCAAAATCTCCGTAATAACACCTCCTCACAGACATTTAGCCATTAAATGCACTTCAAATTCATCGTCTCAGTCACCGGACTTCCCCTCTCCGGCCGACTCCTCAACCACCACCAGCCAGGACACCTTCCCCATCGAGAAACGACGTAGATCCGAGATCCTCAGAGACCGAAGATCCAAATCCGGCCTCGTCAAACCAGAACCTCCGAATTTCGAAGTCGGATGGAA...

CDS

Download CDS FASTA

600 bp · TkA07G441430|TK1151|CDS

ATGGCTTCCTCCACCATTTTCCACCTCTACCCTTTCAAAATCTCCGTAATAACACCTCCTCACAGACATTTAGCCATTAAATGCACTTCAAATTCATCGTCTCAGTCACCGGACTTCCCCTCTCCGGCCGACTCCTCAACCACCACCAGCCAGGACACCTTCCCCATCGAGAAACGACGTAGATCCGAGATCCTCAGAGACCGAAGATCCAAATCCGGCCTCGTCAAACCAGAACCTCCGAATTTCGAAGTCGGATGGAA...

Protein

Download Protein FASTA

199 aa · TkA07G441430|TK1151|PROTEIN

MASSTIFHLYPFKISVITPPHRHLAIKCTSNSSSQSPDFPSPADSSTTTSQDTFPIEKRRRSEILRDRRSKSGLVKPEPPNFEVGWKRTVPIPLEKPVGYVIMDFLEKLEELMGMEYGSTALLAKAGEIVAERAREEAEDLRDDGKVEDRMVTELSRVLKLMEMDLAMVKAAVKEDTLNERLQQAKARCRQAILVASSF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G441430`
TK1151 ID	TkA07G441430
OH-1004 ID	LXL04_030959
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 67.003 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G441430

Location Chr07:111810192-111810791 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51100`	Required for both formation and activity of the chloroplast NAD(P)H dehydrogenase (NDH) complex of the photosynthetic electron transport chain.	Multistep assembly of chloroplast NADH dehydrogenase-like subcomplex A requires several nucleus-encoded proteins, including CRR41 and CRR42, in Arabidopsis.2012 · DOI: 10.1105/tpc.111.090597

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030959 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010258 NADH dehydrogenase complex (plastoquinone) assembly Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT1G51100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.948

Rank 1 · TkA07G441430 · TK1151

Mitochondrion0.050

Rank 2 · TkA07G441430 · TK1151

Nucleus0.048

Rank 3 · TkA07G441430 · TK1151

Cytoplasm0.028

Rank 4 · TkA07G441430 · TK1151

Cell membrane0.014

Rank 5 · TkA07G441430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28703CRR41_C99-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G441430	`PF28703`	CRR41_C	99	196	7.5e-43	145.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C685`	Arabidopsis thaliana	sp\|Q9C685\|CHR41_ARATH Protein CHLORORESPIRATORY REDUCTION 41, chloroplastic	62.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card