TkA07G438750 | RubberDandelionOmics

Gene overview

TkA07G438750

Reference: TK1151 Chr: Chr07 Coordinates: 111100032-111108168 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1205 bp · TkA07G438750|TK1151|cDNA

GTTTTGCTAAGTTAAATCGCAAAAAGAACATCACGAACGTTGTTCCATCATCTTTTTCTCTCTCATTCATCTTGGAGATTTTGATCCCCCGATCTTCGACGAATCTACGAGATATCCATCTAATCTCTCAAGATGCCAGCCACAGCAGGAAGGGTTCGCATGCCCGCCAACAACCGGGTCCATAGCAGTGCCGCCCTCCAAACCCACGGTATCTGGCAAAGTGCAATCGGATACGACCCCTACGCCCCCAACAAAGAAGA...

CDS

Download CDS FASTA

930 bp · TkA07G438750|TK1151|CDS

ATGCCAGCCACAGCAGGAAGGGTTCGCATGCCCGCCAACAACCGGGTCCATAGCAGTGCCGCCCTCCAAACCCACGGTATCTGGCAAAGTGCAATCGGATACGACCCCTACGCCCCCAACAAAGAAGACAACAAGAAATCCGCAGCCCAACCCCAATCCTCCAATCCAGAACCCGAGGGTGAAAACGCCTACGCGTCTTTCCAAGGCTTACTCGCCCTCGCCCGCATCACCGGGTCCAATGCTGACGAGGCGCGCGGGTC...

Protein

Download Protein FASTA

309 aa · TkA07G438750|TK1151|PROTEIN

MPATAGRVRMPANNRVHSSAALQTHGIWQSAIGYDPYAPNKEDNKKSAAQPQSSNPEPEGENAYASFQGLLALARITGSNADEARGSCNKCGRVGHLTFQCRNFLSIKEDKDKDPEAIQAAVMSGLEKIKGNVKRTQIDSDEDESDEDESESSDSDYDSEIEKAIALKYGTKSKSKPKEDEDSDSERRKRGRSKSKSKSKSKSKKKDMSDSDDDVSGKKRKKRREEEERESRRVKRKSRREKRRRRSHRSHRYSDDDSDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G438750`
TK1151 ID	TkA07G438750
OH-1004 ID	LXL04_000594
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.700
Protein coverage (%)	TK1151 42.395 / OH-1004 43.522 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G438750

Location Chr07:111100032-111108168 (+)

Description Similar to CXIP4: CAX-interacting protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g28910`	May regulate CAX1 cation transporter.	Characterization of CXIP4, a novel Arabidopsis protein that activates the H+/Ca2+ antiporter, CAX1.2004 · DOI: 10.1016/s0014-5793(04)00036-5

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000594 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G28910

hsa:285672

mmu:67288

rno:361888

xtr:548753

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.979

Rank 1 · TkA07G438750 · TK1151

Cytoplasm0.087

Rank 2 · TkA07G438750 · TK1151

Cell membrane0.019

Rank 3 · TkA07G438750 · TK1151

Endoplasmic reticulum0.008

Rank 4 · TkA07G438750 · TK1151

Mitochondrion0.008

Rank 5 · TkA07G438750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13917zf-CCHC_384-103 aa

PF00098zf-CCHC87-102 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G438750	`PF13917`	zf-CCHC_3	84	103	1.5e-05	25.4
TkA07G438750	`PF00098`	zf-CCHC	87	102	0.058	14.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84Y18`	Arabidopsis thaliana	sp\|Q84Y18\|CXIP4_ARATH CAX-interacting protein 4	74.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card