TkA07G437610 | RubberDandelionOmics

Gene overview

TkA07G437610

Reference: TK1151 Chr: Chr07 Coordinates: 110779727-110786876 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2294 bp · TkA07G437610|TK1151|cDNA

AAAACTTATACACCAGTTCCCTGATTTAATTCCACCGTAACTCAAAAAATTCAAAACTTTATGAACTCATCACATAACACGTGGCGAAATTCTAGCATACAAACGTTTCTCCGCTCGAGCGGCGATCCTATACGTACTCTCCATTTCTCTCTCTTTCCCTTTCTCCTCCGTCACGGGAAACCAGAGAACAACTTCGCTCTCGCCGTCGTCGTGATCATCATCATCATCATCATCAATGCCTTTTGTAAACTCTCCTTTAT...

CDS

Download CDS FASTA

1866 bp · TkA07G437610|TK1151|CDS

ATGGATAAGAAGAAGTATCCGATCGGAGCAGAGCACTATGCGCTGTATGAGGAAATAGGGCAAGGTGGTAACGCCTATGTTTATCGGGCCAAGTGTCTCGATAACAATGAGATTGTGGCGATCAAAGTTCTCGATTTTGAACAAGGAAACTGCGATTTGAACAACGTATCACGTGAGTCTCAGATAATGATGCTAGTTGATCATCCAAATGTTCTTAAATCACACTGCTCATTCGTAAACGACCATAACCTATGGGTTGT...

Protein

Download Protein FASTA

621 aa · TkA07G437610|TK1151|PROTEIN

MDKKKYPIGAEHYALYEEIGQGGNAYVYRAKCLDNNEIVAIKVLDFEQGNCDLNNVSRESQIMMLVDHPNVLKSHCSFVNDHNLWVVMPFMAGGSCLHMLKAFHPEGFEEVVIATILRETLKALEYLHHHGHIHRDVKAGNILISDQGAIKLGDFGVSACLFDSCDRQRVRNTFVGTPCWMAPEVMEQLHGYDFKADIWSFGITALELAHGHAPFSKYPPMKVLLMTLQNAPPGLDLESDKKFSKSFKQMIASCLVKDPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G437610`
TK1151 ID	TkA07G437610
OH-1004 ID	LXL04_030866
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G437610`
Location	Chr07:110779727-110786876 (+)
Description	Similar to fray2: Serine/threonine-protein kinase fray2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030866` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006468 protein phosphorylation Biological Process GO:0006611 protein export from nucleus Biological Process GO:0006884 cell volume homeostasis Biological Process GO:0006979 response to oxidative stress Biological Process GO:0007165 signal transduction Biological Process GO:0007231 osmosensory signaling pathway Biological Process GO:0009410 response to xenobiotic stimulus Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0038116 chemokine (C-C motif) ligand 21 signaling pathway Biological Process GO:0038146 chemokine (C-X-C motif) ligand 12 signaling pathway Biological Process GO:0046777 protein autophosphorylation Biological Process GO:0070294 renal sodium ion absorption Biological Process
KEGG gene cross-reference	ddi:DDB_G0276577 hsa:9943 mmu:108737 pon:100174028 ssc:397618 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.692

Rank 1 · TkA07G437610 · TK1151

Nucleus0.257

Rank 2 · TkA07G437610 · TK1151

Cell membrane0.200

Rank 3 · TkA07G437610 · TK1151

Golgi apparatus0.086

Rank 4 · TkA07G437610 · TK1151

Mitochondrion0.049

Rank 5 · TkA07G437610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase13-274 aa

PF07714PK_Tyr_Ser-Thr15-270 aa

PF03109ABC125-44 aa

PF03109ABC187-171 aa

PF17667Pkinase_fungal116-197 aa

PF14531Kinase-like122-217 aa

PF14531Kinase-like253-310 aa

PF20863IcmR544-567 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G437610	`PF00069`	Pkinase	13	274	5.9e-61	206.9
TkA07G437610	`PF07714`	PK_Tyr_Ser-Thr	15	270	5.1e-46	157.8
TkA07G437610	`PF03109`	ABC1	25	44	1.1e-05	25.5
TkA07G437610	`PF03109`	ABC1	87	171	1.1e-05	25.5
TkA07G437610	`PF17667`	Pkinase_fungal	116	197	0.00027	20.5
TkA07G437610	`PF14531`	Kinase-like	122	217	0.0039	17.2
TkA07G437610	`PF14531`	Kinase-like	253	310	0.0039	17.2
TkA07G437610	`PF20863`	IcmR	544	567	0.31	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card