RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G437130
Reference: TK1151 Chr: Chr07 Coordinates: 110666880-110671988 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3432 bp · TkA07G437130|TK1151|cDNA

GTCAACGTTGACTCATTCTCACACACCCACTACCGATAACTCGGCTCCTTCTTCCTCCTAGACAAAAAGATGACGCAGAAGGTGTCCTTTGAGGACCCATATAAACAACATCAAAGCTCAAAAACCTTCCAAACCCATCGCCATTGATAACCTTCCTTAAATACCTCAATTCCCTTCACTTTTCATCGTATGCGCCTTCGAATTTTGTTTTATCTTTACAAAATTCATAAAGTTGATCAAAATCTGAGAGATTAGTTTCA...

CDS

Download CDS FASTA

2778 bp · TkA07G437130|TK1151|CDS

ATGCAAATGCAAAAAATGGGTACCGGTGATGGCAGAGATGGGCTGCCGGAGAGTACCCGGTTAACTGATACGGAGGTTGTTGGCTCTGACAGGACGGCGTTTAGTGGTCCGCTGAACAAAAGAAGTACTCGTAAAAGCGCGAGGTTTAATATTCCAGACGACGGCGGTAGTAGCAGCGGCGGTGGAAGTACGAAGTCGAGAAATAACGACGATTACGTTGAGATTACTTTGGATGTCGGCGACGATTCGGTGGCGGTTCA...

Protein

Download Protein FASTA

925 aa · TkA07G437130|TK1151|PROTEIN

MQMQKMGTGDGRDGLPESTRLTDTEVVGSDRTAFSGPLNKRSTRKSARFNIPDDGGSSSGGGSTKSRNNDDYVEITLDVGDDSVAVHSVKTAGGGDLEDPELTLLAKGLEKRSSLGASVVRNASSRIRQVSEELRKLTSFSKRPTGGRLDRTKSAATHALKGLKFISKTDGAAAWAALEKRFDDLTATTTGLLPRALFGECIGMNKDSKEFAGELFDALSRRRNITGNMINKGQLKEFWDQIADQSFDSRLQTFFDMVDK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G437130
TK1151 IDTkA07G437130
OH-1004 IDLXL04_030852
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)97.500
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G437130
LocationChr07:110666880-110671988 (-)
DescriptionSimilar to RBOHC: Respiratory burst oxidase homolog protein C
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g47910 Calcium-dependent NADPH oxidase that generates superoxide.
Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response.2002 · DOI: 10.1073/pnas.012452499
NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.2003 · DOI: 10.1093/emboj/cdg277
Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis.2005 · DOI: 10.1105/tpc.104.026971
Extracellular ATP induces the accumulation of superoxide via NADPH oxidases in Arabidopsis.2006 · DOI: 10.1104/pp.105.073072
The role of NADPH oxidase and MAP kinase phosphatase in UV-B-dependent gene expression in Arabidopsis.2006 · DOI: 10.1111/j.1365-3040.2006.01555.x
Arabidopsis thaliana expresses multiple lines of defense to counterattack Erwinia chrysanthemi.2007 · DOI: 10.1094/mpmi-20-7-0794
The MAP4 Kinase SIK1 Ensures Robust Extracellular ROS Burst and Antibacterial Immunity in Plants.2018 · DOI: 10.1016/j.chom.2018.08.007
At5g51060 Calcium-dependent NADPH oxidase that generates superoxide.
Reactive oxygen species produced by NADPH oxidase regulate plant cell growth.2003 · DOI: 10.1038/nature01485
Hydrogen peroxide mediates plant root cell response to nutrient deprivation.2004 · DOI: 10.1073/pnas.0401707101

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_030852 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0007231 osmosensory signaling pathway Biological Process
GO:0009060 aerobic respiration Biological Process
GO:0009408 response to heat Biological Process
GO:0009611 response to wounding Biological Process
GO:0010053 root epidermal cell differentiation Biological Process
GO:0033198 response to ATP Biological Process
GO:0033500 carbohydrate homeostasis Biological Process
GO:0043069 negative regulation of programmed cell death Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0071456 cellular response to hypoxia Biological Process
GO:0072593 reactive oxygen species metabolic process Biological Process
KEGG gene cross-reference
ath:AT5G47910
ath:AT5G51060
sot:102586476
sot:102598898
sot:102603596
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.855
Rank 1 · TkA07G437130 · TK1151
Cytoplasm0.128
Rank 2 · TkA07G437130 · TK1151
Endoplasmic reticulum0.073
Rank 3 · TkA07G437130 · TK1151
Nucleus0.040
Rank 4 · TkA07G437130 · TK1151
Golgi apparatus0.038
Rank 5 · TkA07G437130 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24430DUF7553122-154 aa
PF08414NADPH_Ox148-249 aa
PF23564EF-hand_FSTL1242-291 aa
PF30624EF_SSP120247-313 aa
PF13499EF-hand_7249-313 aa
PF00036EF-hand_1251-276 aa
PF13405EF-hand_6251-276 aa
PF13202EF-hand_5251-273 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G437130PF24430DUF75531221540.2512.6
TkA07G437130PF08414NADPH_Ox1482491.1e-38132.3
TkA07G437130PF23564EF-hand_FSTL12422910.01516.4
TkA07G437130PF30624EF_SSP1202473130.00617.9
TkA07G437130PF13499EF-hand_72493136.9e-0627.0
TkA07G437130PF00036EF-hand_12512761.4e-0525.0
TkA07G437130PF13405EF-hand_62512760.0002921.0
TkA07G437130PF13202EF-hand_52512730.005516.9
TkA07G437130PF24430DUF75532853080.2512.6
TkA07G437130PF00036EF-hand_12983181.4e-0525.0
TkA07G437130PF13405EF-hand_63003190.0002921.0
TkA07G437130PF01794Ferric_reduct3583964.9e-1349.9
TkA07G437130PF01794Ferric_reduct4165634.9e-1349.9
TkA07G437130PF08022FAD_binding_86077223.8e-37127.4
TkA07G437130PF08030NAD_binding_67289074.4e-50170.5
TkA07G437130PF13499EF-hand_78168296.9e-0627.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FIJ0Arabidopsis thalianasp|Q9FIJ0|RBOHD_ARATH Respiratory burst oxidase homolog protein D69.000%Swiss-ProtHigh
O81210Arabidopsis thalianasp|O81210|RBOHC_ARATH Respiratory burst oxidase homolog protein C71.000%Swiss-ProtHigh

JBrowse

View in Genome Browser