TkA07G436500 | RubberDandelionOmics

Gene overview

TkA07G436500

Reference: TK1151 Chr: Chr07 Coordinates: 110477994-110480204 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1792 bp · TkA07G436500|TK1151|cDNA

AAAATACCATGTATCCAGCTCAGTTTGTAATCATACCACCGCAAAATAACGTTTTTCTTTTTCTGAATTTCTCAATATAAATCCACTTCCATTTCCATCGTCTTCTCCAAATCCCCTGTTCCCATCTATCCCTCTGAAACCACCATTTTCAGACATGCTTTCAAGAGTTAATAGTGTCGTTTGGATGGATGATGAGAGAGGGAATCACTCAAACAACAGAACCGAGCAAAATCATGAACTCAATTCCATTTCTACATTCA...

CDS

Download CDS FASTA

1449 bp · TkA07G436500|TK1151|CDS

ATGCTTTCAAGAGTTAATAGTGTCGTTTGGATGGATGATGAGAGAGGGAATCACTCAAACAACAGAACCGAGCAAAATCATGAACTCAATTCCATTTCTACATTCAAATCAATGCTAGAAGTTGAAGAAGAAGAAAACAACAACAACTGGTTTTTACAGCAGCAGGGGAATCTTCTTTTGCATCCTGTTGATTCTTCATCCTCGTGTTCGCCGTCTTCGGCGTTTCAAAATCATTTCTTTTTACCTCCGAAACCCTCAAT...

Protein

Download Protein FASTA

482 aa · TkA07G436500|TK1151|PROTEIN

MLSRVNSVVWMDDERGNHSNNRTEQNHELNSISTFKSMLEVEEEENNNNWFLQQQGNLLLHPVDSSSSCSPSSAFQNHFFLPPKPSISSILNPNPLDETFDLGCGNGFLGMSRGFCDLGPQTQMGVSNLNSDPQFSTTHLLQLAGNGFGSPALPSLEDGMILNRSKLLKPLDNFASTGAPPTLFQKRAALRRNLSDINTAGGEDGGGGDGVNEKKRKSCGGSWDDVDNLSLDGSGFNYDSDDFTVNTTTNFEENGIKING...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G436500`
TK1151 ID	TkA07G436500
OH-1004 ID	LXL04_023708
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	50.800
Protein coverage (%)	TK1151 83.195 / OH-1004 78.229 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G436500

Location Chr07:110477994-110480204 (+)

Description Similar to SCRM: Transcription factor ICE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26744`	Transcriptional activator that regulates the cold-induced transcription of CBF/DREB1 genes.	SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048397 SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At1g12860`	Mediates stomatal differentiation in the epidermis probably by controlling successive roles of SPCH, MUTE, and FAMA.	SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At5g65640`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0544200`	Probable transcription factor.	No verified direct reference in this release
`Os03g0135700`	Transcription factor involved in defense responses that functions downstream of RAC1 and upstream of PAL1 and WRKY19 genes.	The bHLH Rac Immunity1 (RAI1) Is Activated by OsRac1 via OsMAPK3 and OsMAPK6 in Rice Immunity.2012 · DOI: 10.1093/pcp/pcs033

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023708 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009960 endosperm development Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010371 regulation of gibberellin biosynthetic process Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0010444 guard mother cell differentiation Biological Process

GO:0031347 regulation of defense response Biological Process

KEGG gene cross-reference

ath:AT1G12860

ath:AT3G26744

ath:AT5G10570

ath:AT5G65640

dosa:Os03g0135700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.972

Rank 1 · TkA07G436500 · TK1151

Cytoplasm0.088

Rank 2 · TkA07G436500 · TK1151

Cell membrane0.030

Rank 3 · TkA07G436500 · TK1151

Endoplasmic reticulum0.021

Rank 4 · TkA07G436500 · TK1151

Plastid0.014

Rank 5 · TkA07G436500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00709Adenylsucc_synt263-347 aa

PF00010HLH291-333 aa

PF23177bHLH_IRO3291-342 aa

PF23173bHLH_SAC51293-336 aa

PF22754bHLH-TF_ACT-like_plant399-473 aa

PF26956ACT_ACR_D1412-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G436500	`PF00709`	Adenylsucc_synt	263	347	0.11	12.0
TkA07G436500	`PF00010`	HLH	291	333	1.3e-09	38.4
TkA07G436500	`PF23177`	bHLH_IRO3	291	342	3.1e-06	28.2
TkA07G436500	`PF23173`	bHLH_SAC51	293	336	4.8e-07	30.3
TkA07G436500	`PF22754`	bHLH-TF_ACT-like_plant	399	473	2.1e-12	47.6
TkA07G436500	`PF26956`	ACT_ACR_D1	412	456	0.0072	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSE2`	Arabidopsis thaliana	sp\|Q9LSE2\|ICE1_ARATH Transcription factor ICE1	53.600%	Swiss-Prot	High
`Q9LPW3`	Arabidopsis thaliana	sp\|Q9LPW3\|SCRM2_ARATH Transcription factor SCREAM2	53.900%	Swiss-Prot	High
`Q9LSL1`	Arabidopsis thaliana	sp\|Q9LSL1\|BH093_ARATH Transcription factor bHLH93	42.100%	Swiss-Prot	Low
`Q336V8`	Oryza sativa subsp. japonica	sp\|Q336V8\|BH004_ORYSJ Basic helix-loop-helix protein 004	45.900%	Swiss-Prot	Low
`Q10S44`	Oryza sativa subsp. japonica	sp\|Q10S44\|BH003_ORYSJ Transcription factor BHLH3	40.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card