TkA07G432940 | RubberDandelionOmics

Gene overview

TkA07G432940

Reference: TK1151 Chr: Chr07 Coordinates: 109546781-109552393 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3590 bp · TkA07G432940|TK1151|cDNA

AATTACAACACCAAAAATATGTTGGATTGGGCACCAATCTTGGTAGGATTAATGTTGTTCATACTTTTGTCACCGGGACTAATTTTTCAAATCCCTGGAAACACACGTACTGTTGAATTTGGCAACTTTGGCACCAATGGAAAAGCTGTGATAGTCCACACCCTTCTTTTCTTTGGCGCGTTCACTATATTAATTTTGGCTACCGGAATGCATATTTACACGGGAGAAGAGCACGTGAAAACACGATGGATCTGCACACA...

CDS

Download CDS FASTA

1764 bp · TkA07G432940|TK1151|CDS

ATGTCTCCACCCCCATCATCTTCTGCAGTGTGCTCATCAGAAGAGGATGATGTTATTATCGCCGCCCCTTCTGCCGCTTGGGCTCACTTGCAAATCGTTTATGATATCCTACTCCGGTTGATAATCAAGAATGACGTTAAAGCCCTTCGAGGGGAATACAATGGTGGAGCTAGAACTTTAAACCAGGGTATGCTCCGGAGGGAACATTTCATTGGCCGGAATTTCGTTCTAAACCTCCTTACTCTCTTCAACTCCGATGA...

Protein

Download Protein FASTA

587 aa · TkA07G432940|TK1151|PROTEIN

MSPPPSSSAVCSSEEDDVIIAAPSAAWAHLQIVYDILLRLIIKNDVKALRGEYNGGARTLNQGMLRREHFIGRNFVLNLLTLFNSDEPRERDAVKNIVHRIYSKFTFYRSFMRQAMIDIFLRFIYEPDHRQNGIGEILEIWGSIINGLMVPLKDEHKAFLSRVLIPLHKPKNMAVYHRQLSYCVSQFVQKEAELGAVVIGKVLRYWPVTNCRKEVLLIGEMEEIAENIDRRQYLKVALPLWIQITKCITSNNSQVAERAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G432940`
TK1151 ID	TkA07G432940
OH-1004 ID	LXL04_030810
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 56.218 / OH-1004 68.323 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G432940

Location Chr07:109546781-109552393 (+)

Description Similar to B'ALPHA: Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' alpha isoform

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09880`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At5g03470`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At3g26020`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).	No verified direct reference in this release
`At5g25510`	The B regulatory subunit may modulate substrate selectivity and catalytic activity, and may also direct the localization of the catalytic enzyme to a particular subcellular compartment.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0555100`	B regulatory subunit of phosphatase 2A (PP2A) involved in salt stress response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030810 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009554 megasporogenesis Biological Process

GO:0009556 microsporogenesis Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0042325 regulation of phosphorylation Biological Process

GO:0051177 meiotic sister chromatid cohesion Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:0000159 protein phosphatase type 2A complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G09880

ath:AT3G26020

ath:AT5G03470

ath:AT5G25510

dosa:Os05g0555100

osa:4339558

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.480

Rank 1 · TkA07G432940 · TK1151

Nucleus0.380

Rank 2 · TkA07G432940 · TK1151

Cell membrane0.104

Rank 3 · TkA07G432940 · TK1151

Golgi apparatus0.089

Rank 4 · TkA07G432940 · TK1151

Endoplasmic reticulum0.083

Rank 5 · TkA07G432940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01603B565-347 aa

PF12783Sec7-like_HUS111-181 aa

PF06595BDV_P24162-190 aa

PF12783Sec7-like_HUS244-290 aa

PF06595BDV_P24272-330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G432940	`PF01603`	B56	5	347	2.7e-105	353.4
TkA07G432940	`PF12783`	Sec7-like_HUS	111	181	0.1	13.1
TkA07G432940	`PF06595`	BDV_P24	162	190	0.086	13.4
TkA07G432940	`PF12783`	Sec7-like_HUS	244	290	0.1	13.1
TkA07G432940	`PF06595`	BDV_P24	272	330	0.086	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04376`	Arabidopsis thaliana	sp\|O04376\|2A5B_ARATH Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' beta isoform	43.800%	Swiss-Prot	Medium
`O04375`	Arabidopsis thaliana	sp\|O04375\|2A5A_ARATH Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' alpha isoform	43.600%	Swiss-Prot	Medium
`Q9LU89`	Arabidopsis thaliana	sp\|Q9LU89\|2A5N_ARATH Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' eta isoform	43.900%	Swiss-Prot	Medium
`Q93YV6`	Arabidopsis thaliana	sp\|Q93YV6\|2A5K_ARATH Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' kappa isoform	41.800%	Swiss-Prot	Medium
`Q6I621`	Oryza sativa subsp. japonica	sp\|Q6I621\|2A5K_ORYSJ Serine/threonine protein phosphatase 2A 57 kDa regulatory subunit B' kappa isoform	43.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card