TkA07G430290 | RubberDandelionOmics

Gene overview

TkA07G430290

Reference: TK1151 Chr: Chr07 Coordinates: 108888411-108891161 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1996 bp · TkA07G430290|TK1151|cDNA

ATAAACTTCAATACTTTCTTCATAAACTCTAAACATACACACACCAGAAAAAATGGCAATGAGTTATGGGTACTACGGCGACACCGCCATGAAGAAAATCCCCGGCGGCGGCGGCGGCGTCGGTGGAAGATACGACGTTCCGGAGGGAGTAGACATCAGGGGGAGATTCGACGAGGAGTTCGCCAAGATTCTTACGAAAGATGCTTTGGTATTTGTGGCTGCTTTACATAGGGAGTTTAGGAACCATGTTAAGTATGCTA...

CDS

Download CDS FASTA

1725 bp · TkA07G430290|TK1151|CDS

ATGGCAATGAGTTATGGGTACTACGGCGACACCGCCATGAAGAAAATCCCCGGCGGCGGCGGCGGCGTCGGTGGAAGATACGACGTTCCGGAGGGAGTAGACATCAGGGGGAGATTCGACGAGGAGTTCGCCAAGATTCTTACGAAAGATGCTTTGGTATTTGTGGCTGCTTTACATAGGGAGTTTAGGAACCATGTTAAGTATGCTATGGAGTGTAGGAAAGAGGCTAAGATGAGGTATAACTCCGGTGGGTTGCCGGG...

Protein

Download Protein FASTA

574 aa · TkA07G430290|TK1151|PROTEIN

MAMSYGYYGDTAMKKIPGGGGGVGGRYDVPEGVDIRGRFDEEFAKILTKDALVFVAALHREFRNHVKYAMECRKEAKMRYNSGGLPGFDPATKNVRDGDWVCAEVPPAVADRRVEITGPVERKMIINALNSGAKVFMADFEDALSPTWENLMRGQVNLKDAVNGTISFEDKTRNRVYKLNDQIAKLFVRPRGWHLPEAHIFIDGEPAIGCLVDFGLYFHHNHASFRKTQGQGYGPFFYLPKMENSREARIWNNVFERAEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G430290`
TK1151 ID	TkA07G430290
OH-1004 ID	LXL04_030779
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G430290

Location Chr07:108888411-108891161 (-)

Description Similar to Malate synthase, glyoxysomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03860`	Does not seem to be essential for lipid utilization and gluconeogenesis in seedlings.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030779 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006097 glyoxylate cycle Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009514 glyoxysome Cellular Component

GO:0004474 malate synthase activity Molecular Function

KEGG gene cross-reference

ath:AT5G03860

rcu:8266340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.510

Rank 1 · TkA07G430290 · TK1151

Peroxisome0.253

Rank 2 · TkA07G430290 · TK1151

Nucleus0.178

Rank 3 · TkA07G430290 · TK1151

Mitochondrion0.163

Rank 4 · TkA07G430290 · TK1151

Cell membrane0.068

Rank 5 · TkA07G430290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20656MS_N31-93 aa

PF03328HpcH_HpaI122-148 aa

PF01274MS_TIM-barrel185-436 aa

PF03328HpcH_HpaI237-309 aa

PF22484DUF6986237-285 aa

PF20659MS_C441-563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G430290	`PF20656`	MS_N	31	93	4.8e-23	81.2
TkA07G430290	`PF03328`	HpcH_HpaI	122	148	0.00022	21.3
TkA07G430290	`PF01274`	MS_TIM-barrel	185	436	3e-117	390.7
TkA07G430290	`PF03328`	HpcH_HpaI	237	309	0.00022	21.3
TkA07G430290	`PF22484`	DUF6986	237	285	0.068	12.7
TkA07G430290	`PF20659`	MS_C	441	563	9.8e-43	146.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZC3`	Arabidopsis thaliana	sp\|Q9LZC3\|MASY_ARATH Malate synthase	83.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card