TkA07G429690 | RubberDandelionOmics

Gene overview

TkA07G429690

Reference: TK1151 Chr: Chr07 Coordinates: 108771030-108774514 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2336 bp · TkA07G429690|TK1151|cDNA

CCTATGCTTACTTTTTCTCTACAATTTGGTCAGCCTAGTTTCTTACACTACATAACTAATCAAACCAACTTTATCCACACTGAGCTGAGCTAGTGAAAATGCAAACCCTCTTAAACCCTCATCCCATCTCCTTCCTTCCTCCAAGAATCCTAAATCCTATCAAGCTATTCAAATCCAGCAATCAAAACCCTTCACTTCACCTCATCTCCACCGGAAAATTCACCGTTAAGGGTTTATCATCAGACGAGTTCCCCGTCGAT...

CDS

Download CDS FASTA

1989 bp · TkA07G429690|TK1151|CDS

ATGCAAACCCTCTTAAACCCTCATCCCATCTCCTTCCTTCCTCCAAGAATCCTAAATCCTATCAAGCTATTCAAATCCAGCAATCAAAACCCTTCACTTCACCTCATCTCCACCGGAAAATTCACCGTTAAGGGTTTATCATCAGACGAGTTCCCCGTCGATGAGGATTTCATCGAAAAATTCGGCCCCAAAGACGTGGAAACTGAAGACGAAGCTCGTCGACGCAACTGGATCGAAGGAGGTTGGGCTCCATGGGAGGA...

Protein

Download Protein FASTA

662 aa · TkA07G429690|TK1151|PROTEIN

MQTLLNPHPISFLPPRILNPIKLFKSSNQNPSLHLISTGKFTVKGLSSDEFPVDEDFIEKFGPKDVETEDEARRRNWIEGGWAPWEEILTPEGNFARKSLNEGEEVELQNPDSIEAFKMLRPSYRKKKMEELGLTEDEFYAKQFELKGDIPEPLKTTWAGPLVVRHVPPRDWPPKGWEVDKKELEFIREAHKFSATVDLHQVQNEAKSNTDDLCLDRYKVFLRQYNEWVEANRDRLEEESYKYDQDYYPGRRKRGKDYKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G429690`
TK1151 ID	TkA07G429690
OH-1004 ID	LXL04_030772
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G429690

Location Chr07:108771030-108774514 (+)

Description Similar to PTAC10: Protein PLASTID TRANSCRIPTIONALLY ACTIVE 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48500`	Protein PLASTID TRANSCRIPTIONALLY ACTIVE 10.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030772 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000427 plastid-encoded plastid RNA polymerase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G48500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.834

Rank 1 · TkA07G429690 · TK1151

Nucleus0.094

Rank 2 · TkA07G429690 · TK1151

Mitochondrion0.083

Rank 3 · TkA07G429690 · TK1151

Cytoplasm0.024

Rank 4 · TkA07G429690 · TK1151

Cell membrane0.015

Rank 5 · TkA07G429690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28712PTAC10_helical45-51 aa

PF28711PTAC10_N68-105 aa

PF28712PTAC10_helical111-148 aa

PF12226Astro_capsid_p597-641 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G429690	`PF28712`	PTAC10_helical	45	51	9.3e-25	87.0
TkA07G429690	`PF28711`	PTAC10_N	68	105	7.5e-21	73.9
TkA07G429690	`PF28712`	PTAC10_helical	111	148	9.3e-25	87.0
TkA07G429690	`PF12226`	Astro_capsid_p	597	641	0.19	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JF21`	Arabidopsis thaliana	sp\|F4JF21\|PTA10_ARATH Protein PLASTID TRANSCRIPTIONALLY ACTIVE 10	67.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card