RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G426560
Reference: TK1151 Chr: Chr07 Coordinates: 107863954-107868693 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1755 bp · TkA07G426560|TK1151|cDNA

ATGCTCATGGCATCATCACCTCACTTTCTTTATTTCTCATTCTTCATCATTTCTTTCACACAAGTTCCTGTTCTTTCCCTCAATGTTGTCATAAAATCAACACTTATGTACCCACTAACTTGTTCTAATTACACTCATACATGCAATTCCTATCTCTACCACATCTCCAAAGGCCACAATCTCCAAGAAATCGCATCTTTCTACTCTCTCAACACCTCCAAACTCACACCCATAAAACACAATATCAATACCGATTATCT...

CDS

Download CDS FASTA

1755 bp · TkA07G426560|TK1151|CDS

ATGCTCATGGCATCATCACCTCACTTTCTTTATTTCTCATTCTTCATCATTTCTTTCACACAAGTTCCTGTTCTTTCCCTCAATGTTGTCATAAAATCAACACTTATGTACCCACTAACTTGTTCTAATTACACTCATACATGCAATTCCTATCTCTACCACATCTCCAAAGGCCACAATCTCCAAGAAATCGCATCTTTCTACTCTCTCAACACCTCCAAACTCACACCCATAAAACACAATATCAATACCGATTATCT...

Protein

Download Protein FASTA

584 aa · TkA07G426560|TK1151|PROTEIN

MLMASSPHFLYFSFFIISFTQVPVLSLNVVIKSTLMYPLTCSNYTHTCNSYLYHISKGHNLQEIASFYSLNTSKLTPIKHNINTDYLVSIQCSCKKDNITNDGYYSYDSVYKRKPGESVEFISNEYYSGQVWNVSGENEELNVHLVCGCLLENEFDQEVVTYTVQSGDTLIGISELLAAKEVEVENMNSGLTKNPNSIDVGWVLFVPRDKNKTRASKPRKIKTWMIIVFIVLALVLVLVLVALSLLFLLKKRRDGVIKND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G426560
TK1151 IDTkA07G426560
OH-1004 IDLXL04_025827
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)50.800
Protein coverage (%)TK1151 91.952 / OH-1004 88.691
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G426560
LocationChr07:107863954-107868693 (-)
DescriptionSimilar to LYK3: LysM domain receptor-like kinase 3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g51940 Putative Lysin motif (LysM) receptor kinase that may recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands. No verified direct reference in this release
At3g21630 Lysin motif (LysM) receptor kinase that functions as a cell surface receptor in chitin elicitor (chitooligosaccharides) signaling leading to innate immunity toward both biotic and abiotic stresses (e.g. tolerance to salinity, heavy-metal stresses, and Botrytis cinerea infection).
CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis.2007 · DOI: 10.1073/pnas.0705147104
AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants.2009 · DOI: 10.1016/j.cub.2009.01.054
The lysin motif receptor-like kinase (LysM-RLK) CERK1 is a major chitin-binding protein in Arabidopsis thaliana and subject to chitin-induced phosphorylation.2010 · DOI: 10.1074/jbc.m110.116657
Arabidopsis lysin-motif proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immunity to bacterial infection.2011 · DOI: 10.1073/pnas.1112862108
The LysM receptor-like kinase LysM RLK1 is required to activate defense and abiotic-stress responses induced by overexpression of fungal chitinases in Arabidopsis plants.2012 · DOI: 10.1093/mp/sss021
Functional characterization of CEBiP and CERK1 homologs in arabidopsis and rice reveals the presence of different chitin receptor systems in plants.2012 · DOI: 10.1093/pcp/pcs113
Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27.2014 · DOI: 10.1111/tpj.12535

Rice

Reference gene IDPossible functionPapers / DOI
Os08g0538300 Lysin motif (LysM) receptor kinase required as a cell surface receptor for chitin elicitor (chitooligosaccharides) signaling leading to innate immunity in response to biotic stresses.
Two LysM receptor molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice.2010 · DOI: 10.1111/j.1365-313x.2010.04324.x
Functional characterization of CEBiP and CERK1 homologs in arabidopsis and rice reveals the presence of different chitin receptor systems in plants.2012 · DOI: 10.1093/pcp/pcs113
A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007
Targeted gene disruption of OsCERK1 reveals its indispensable role in chitin perception and involvement in the peptidoglycan response and immunity in rice.2014 · DOI: 10.1094/mpmi-03-14-0068-r
OsCERK1 and OsRLCK176 play important roles in peptidoglycan and chitin signaling in rice innate immunity.2014 · DOI: 10.1111/tpj.12710
Os09g0511000 LysM domain receptor-like kinase 10. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_025827 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0002752 cell surface pattern recognition receptor signaling pathway Biological Process
GO:0002758 innate immune response-activating signaling pathway Biological Process
GO:0006468 protein phosphorylation Biological Process
GO:0006952 defense response Biological Process
GO:0009609 response to symbiotic bacterium Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0009877 nodulation Biological Process
GO:0010200 response to chitin Biological Process
GO:0031348 negative regulation of defense response Biological Process
GO:0032491 detection of molecule of fungal origin Biological Process
KEGG gene cross-reference
ath:AT1G51940
ath:AT3G21630
dosa:Os08g0538300
dosa:Os09g0511000
osa:9270778
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.762
Rank 1 · TkA07G426560 · TK1151
Endoplasmic reticulum0.131
Rank 2 · TkA07G426560 · TK1151
Cytoplasm0.088
Rank 3 · TkA07G426560 · TK1151
Lysosome / Vacuole0.063
Rank 4 · TkA07G426560 · TK1151
Nucleus0.051
Rank 5 · TkA07G426560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23446LysM1_NFP_LYK47-94 aa
PF01476LysM53-75 aa
PF27655GDU_TM87-97 aa
PF01476LysM114-126 aa
PF23446LysM1_NFP_LYK160-207 aa
PF01476LysM162-207 aa
PF28682TTMP_N219-240 aa
PF27867Membra_charge221-286 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G426560PF23446LysM1_NFP_LYK47940.009717.5
TkA07G426560PF01476LysM53755.2e-0523.8
TkA07G426560PF27655GDU_TM87970.09813.2
TkA07G426560PF01476LysM1141265.2e-0523.8
TkA07G426560PF23446LysM1_NFP_LYK1602070.009717.5
TkA07G426560PF01476LysM1622075.2e-0523.8
TkA07G426560PF28682TTMP_N2192400.1612.2
TkA07G426560PF27867Membra_charge2212863.28.5
TkA07G426560PF00335Tetraspanin2222750.09813.0
TkA07G426560PF30011EXP12232920.09713.7
TkA07G426560PF29364TED62252530.02415.2
TkA07G426560PF28533DUF84292292910.06913.7
TkA07G426560PF27655GDU_TM2292630.09813.2
TkA07G426560PF15330SIT2302690.1913.0
TkA07G426560PF27867Membra_charge2993143.28.5
TkA07G426560PF00069Pkinase3135325.3e-46157.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4IB81Arabidopsis thalianasp|F4IB81|LYK3_ARATH LysM domain receptor-like kinase 346.900%Swiss-ProtLow
A8R7E6Arabidopsis thalianasp|A8R7E6|CERK1_ARATH Chitin elicitor receptor kinase 149.100%Swiss-ProtLow
A0A0P0XII1Oryza sativa subsp. japonicasp|A0A0P0XII1|CERK1_ORYSJ Chitin elicitor receptor kinase 147.500%Swiss-ProtLow
D7UPN3Oryza sativa subsp. japonicasp|D7UPN3|RLK10_ORYSJ LysM domain receptor-like kinase 1044.700%Swiss-ProtMedium

JBrowse

View in Genome Browser