Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4927 bp · TkA07G422500|TK1151|cDNA
TAAATATCGGATATTCGAATCAAGAAAAAGGGTCAATGTCAAAAGCCACATTTGAAAAGCACCGAGAGATTAAAAAAAGCCCTCTTTTGATAAGACCTTTCATACACAACTACGCCGATCGCTGCGGTGGGATGCCACCACCCACCACCGCCTTCTGTTAACATCGGGATTTGAACTCATATCATCACCATTTCTCTCCATATATCAGTAAGCATCATCTTATTCTGTATCTGTCTATAAATCTCGAACTTCAATGTATC...
4188 bp · TkA07G422500|TK1151|CDS
ATGGGGCGTAAAAAGCGAAACGTCGCTACTCGCTCCAAGGCTGCGATACCTGCTGCTGATCCTAATCCGCTGCAGCTTTCCGTTGGAATTGACCGCGATGGTGATGGTGATGTTAGTTCACTCACTACGGAACATAAATTGAGTGTGAATTCGTCGATTGTACATGAGATACATCCAAACCTAGAAAACGAAGTCTCGTTAGCGATTGAATCAGATGGTTACTCTGCTGTGAAAGTTGAGTGCGAGAAAGCTCTAAATGC...
Protein
Download Protein FASTA1395 aa · TkA07G422500|TK1151|PROTEIN
MGRKKRNVATRSKAAIPAADPNPLQLSVGIDRDGDGDVSSLTTEHKLSVNSSIVHEIHPNLENEVSLAIESDGYSAVKVECEKALNALRRGNHTKALRLMKEMCAKHENKANLALIHRVQGTVCVKVASIIDDPNGKQRHLKNAIESAKKAVMLSPNSAEFAHFYANLLYETANDGKDYEDSVQECERALSITNPIDPGKESLQDESQQKLSSPDARIGHVQNELKALLQKANLGTISSWMKNLGNGEEKFRIIPIRRAP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G422500 |
|---|---|
| TK1151 ID | TkA07G422500 |
| OH-1004 ID | LXL04_030668 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 91.530Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G422500 |
|---|---|
| Location | Chr07:106781530-106789416 (+) |
| Description | Similar to Usp54: Inactive ubiquitin carboxyl-terminal hydrolase 54 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001508 action potential Biological Process GO:0006508 proteolysis Biological Process GO:0010996 response to auditory stimulus Biological Process GO:0016579 protein deubiquitination Biological Process GO:0005911 cell-cell junction Cellular Component GO:0005923 bicellular tight junction Cellular Component GO:0004843 cysteine-type deubiquitinase activity Molecular Function GO:0046872 metal ion binding Molecular Function GO:0061578 K63-linked deubiquitinase activity Molecular Function |
| KEGG gene cross-reference | hsa:159195 hsa:54532 mmu:78787 mmu:99526 rno:408223 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07719TPR_283-105 aaPF04781DUF62784-194 aaPF12895ANAPC385-107 aaPF14559TPR_1987-114 aaPF21033RMD1-393-173 aaPF28485FBXO43_helical96-110 aaPF07719TPR_2137-157 aaPF12895ANAPC3138-172 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G422500 | PF07719 | TPR_2 | 83 | 105 | 0.31 | 12.0 |
| TkA07G422500 | PF04781 | DUF627 | 84 | 194 | 7.8e-31 | 106.9 |
| TkA07G422500 | PF12895 | ANAPC3 | 85 | 107 | 3.0 | 8.9 |
| TkA07G422500 | PF14559 | TPR_19 | 87 | 114 | 7.4 | 7.7 |
| TkA07G422500 | PF21033 | RMD1-3 | 93 | 173 | 0.00088 | 19.2 |
| TkA07G422500 | PF28485 | FBXO43_helical | 96 | 110 | 0.14 | 13.3 |
| TkA07G422500 | PF07719 | TPR_2 | 137 | 157 | 0.31 | 12.0 |
| TkA07G422500 | PF12895 | ANAPC3 | 138 | 172 | 3.0 | 8.9 |
| TkA07G422500 | PF14559 | TPR_19 | 139 | 174 | 7.4 | 7.7 |
| TkA07G422500 | PF07719 | TPR_2 | 177 | 192 | 0.31 | 12.0 |
| TkA07G422500 | PF14559 | TPR_19 | 288 | 312 | 7.4 | 7.7 |
| TkA07G422500 | PF04780 | DUF629 | 352 | 624 | 1e-99 | 335.1 |
| TkA07G422500 | PF12895 | ANAPC3 | 372 | 405 | 3.0 | 8.9 |
| TkA07G422500 | PF00443 | UCH | 404 | 435 | 1.6e-28 | 100.8 |
| TkA07G422500 | PF04780 | DUF629 | 631 | 799 | 1e-99 | 335.1 |
| TkA07G422500 | PF04781 | DUF627 | 686 | 709 | 7.8e-31 | 106.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.