TkA07G420720 | RubberDandelionOmics

Gene overview

TkA07G420720

Reference: TK1151 Chr: Chr07 Coordinates: 106299965-106302166 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1147 bp · TkA07G420720|TK1151|cDNA

CTCGAAGTACCGAATATTTTACTCTTCGCAAAACCCTAATTCCTTTGTTGTTAAACTCCTTAAAACCCTAGACAACAGAAACCATTGATCCCTCTTCCCCTGTTCCCACAAATCTCCGCCCGTGTACACATCCTCTCCGTGAAGAGAGCTAGAATAGTTTTTGCTTCCAGTCAAGCCAATTTAGGGTTTCTATAATGGTGGCTGACAAGGGTAAGAAGCCCAAAATCGGAGAGAAAACCGCGGAAGAGGGCGTTGAGGAA...

CDS

Download CDS FASTA

750 bp · TkA07G420720|TK1151|CDS

ATGGTGGCTGACAAGGGTAAGAAGCCCAAAATCGGAGAGAAAACCGCGGAAGAGGGCGTTGAGGAAATTGACCTTGAGCTTGTTAAATCCATTGAGAAGCTGCAAGAGGTCCAAGATGAGCTCGAAAAGATCAACGAGGAAGCAAGTGATAAAGTTTTGGAGGTCGAGCAGAAATACAACGAAGTTCGGAAACCAGTGTACGGTAAACGTAATGACATCATCAAAGCGATTCCTGATTTTTGGCTAACTGCTTTCTTGAG...

Protein

Download Protein FASTA

249 aa · TkA07G420720|TK1151|PROTEIN

MVADKGKKPKIGEKTAEEGVEEIDLELVKSIEKLQEVQDELEKINEEASDKVLEVEQKYNEVRKPVYGKRNDIIKAIPDFWLTAFLSHPALADLLNEEDQKIFKHLTSLEVEDNKDVKSGFSITFNFSPNPYFEDTKLTKTVTFLDEGTTKITATSIKWKEGMGLSNGVTHEKNGNKRPHEDDSFFSWFSGTQREDDMEEVQDGVAEIIKEDLWVNPLTYFNNDADEEDFGDEEDEEDIGTDDSEEDED

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G420720`
TK1151 ID	TkA07G420720
OH-1004 ID	LXL04_031421
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.800
Protein coverage (%)	TK1151 91.968 / OH-1004 87.405 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G420720

Location Chr07:106299965-106302166 (+)

Description Similar to NRP2: NAP1-related protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18800`	Acts as a histone H2A/H2B chaperone in nucleosome assembly, playing a critical role for the correct expression of genes involved in root proliferation and patterning.	Arabidopsis NRP1 and NRP2 encode histone chaperones and are required for maintaining postembryonic root growth.2006 · DOI: 10.1105/tpc.106.046490 Chromatin remodeling in Arabidopsis root growth.2007 · DOI: 10.4161/psb.2.3.3687 NAP1 family histone chaperones are required for somatic homologous recombination in Arabidopsis.2012 · DOI: 10.1105/tpc.112.096792
`At1g74560`	Acts as a histone H2A/H2B chaperone in nucleosome assembly, playing a critical role for the correct expression of genes involved in root proliferation and patterning.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0576700`	Acts as a histone H2A/H2B chaperone in nucleosome assembly.	No verified direct reference in this release
`UniProt: B8AEC1`	Acts as a histone H2A/H2B chaperone in nucleosome assembly.	No verified direct reference in this release
`UniProt: A2XU85`	Acts as a histone H2A/H2B chaperone in nucleosome assembly.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031421 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006334 nucleosome assembly Biological Process

GO:0016444 somatic cell DNA recombination Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003682 chromatin binding Molecular Function

GO:0042393 histone binding Molecular Function

KEGG gene cross-reference

ath:AT1G18800

ath:AT1G74560

dosa:Os02g0576700

dosa:Os04g0459700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.652

Rank 1 · TkA07G420720 · TK1151

Nucleus0.563

Rank 2 · TkA07G420720 · TK1151

Mitochondrion0.054

Rank 3 · TkA07G420720 · TK1151

Endoplasmic reticulum0.044

Rank 4 · TkA07G420720 · TK1151

Cell membrane0.044

Rank 5 · TkA07G420720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07889DUF166419-65 aa

PF15679DUF466528-66 aa

PF00956NAP30-75 aa

PF07516SecA_SW33-76 aa

PF00956NAP75-212 aa

PF20616Caps_syn_GfcC_N80-119 aa

PF14617CMS185-129 aa

PF03937Sdh590-112 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G420720	`PF07889`	DUF1664	19	65	0.6	10.9
TkA07G420720	`PF15679`	DUF4665	28	66	0.054	14.8
TkA07G420720	`PF00956`	NAP	30	75	2.9e-34	119.2
TkA07G420720	`PF07516`	SecA_SW	33	76	0.0091	16.8
TkA07G420720	`PF00956`	NAP	75	212	2.9e-34	119.2
TkA07G420720	`PF20616`	Caps_syn_GfcC_N	80	119	0.083	13.9
TkA07G420720	`PF14617`	CMS1	85	129	0.027	14.6
TkA07G420720	`PF03937`	Sdh5	90	112	0.04	14.6
TkA07G420720	`PF03937`	Sdh5	181	208	0.04	14.6
TkA07G420720	`PF07889`	DUF1664	197	205	0.6	10.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LC68`	Arabidopsis thaliana	sp\|Q8LC68\|NRP2_ARATH NAP1-related protein 2	75.800%	Swiss-Prot	High
`Q9CA59`	Arabidopsis thaliana	sp\|Q9CA59\|NRP1_ARATH NAP1-related protein 1	72.800%	Swiss-Prot	High
`Q69JW2`	Oryza sativa subsp. japonica	sp\|Q69JW2\|NRP2_ORYSJ NAP1-related protein 2	65.900%	Swiss-Prot	High
`B8AEC1`	Oryza sativa subsp. indica	sp\|B8AEC1\|NRP2_ORYSI NAP1-related protein 2	65.900%	Swiss-Prot	High
`A2XU85`	Oryza sativa subsp. indica	sp\|A2XU85\|NRP1_ORYSI NAP1-related protein 1	60.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card