TkA07G415400 | RubberDandelionOmics

Gene overview

TkA07G415400

Reference: TK1151 Chr: Chr07 Coordinates: 104987562-104990094 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1942 bp · TkA07G415400|TK1151|cDNA

TCTCTCTCTCTCTCTCTCTCTCAGACACACTTACGCTAAAAACGGAGATCTCCGGCTGAATTCAGTGATGCTAACTTCTGTCGTTTGATCGCCGGGATTCCAGATGGATTTGAGCCGTTGATTTTAGCTGTTTGCCTGTTTCAGATCGTGACAGACTAGTTTTTCGAACAGCAGGAGGATTTGTTTGTTTAATCTCCATTTCTGAACTTGTGTTTTCGTTCATTTTTAGTTTTGTGAGAACTGTGGTGATCTCATGTGAA...

CDS

Download CDS FASTA

1368 bp · TkA07G415400|TK1151|CDS

ATGCGGGAGATGGACGGATTTATTGATCGGAGTAAAGTGAGAATTTTACTTTGCGATAATGATTCCAAGGGTTCAGGAGAGGTTTTTACTCTTCTTCGTAAATGTTCCTATCAAGTAATTTCAGTGAAATCGCCCAGGCAAGTGATCGATGCTTTGAATGCTGAAGGACCCAACATTGATCTCATTCTTTCAGAAGTCGATCTTCCTATGGCCAAAGGCTTGAAGATGCTAAAATACATCATGAGAAAAGAGTCGCAACT...

Protein

Download Protein FASTA

455 aa · TkA07G415400|TK1151|PROTEIN

MREMDGFIDRSKVRILLCDNDSKGSGEVFTLLRKCSYQVISVKSPRQVIDALNAEGPNIDLILSEVDLPMAKGLKMLKYIMRKESQLQRIPVIMMSAQDEVTLVVKCLRLGAADYLVKPLRTNELLNLWTHMWRRRRMLGLTEIKLMNCEFDLVHSDHSDVNTNSTVFSDDTDERPRKNANQDISVSIHHENQINVILSNNQSYLPETKNHQQGCGPKKSELKMGESSAFFTYIKSNMSTKSKTTPVVSILDKEPYTDNQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G415400`
TK1151 ID	TkA07G415400
OH-1004 ID	LXL04_030615
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G415400

Location Chr07:104987562-104990094 (+)

Description Similar to PRR1: Two-component response regulator-like PRR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61380`	Controls photoperiodic flowering response.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043 A functional genomics approach reveals CHE as a component of the Arabidopsis circadian clock.2009 · DOI: 10.1126/science.1167206
`At2g46790`	Transcriptional repressor of CCA1 and LHY, and positive regulator of LWD1 and LWD2 expression.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043
`At5g60100`	Controls photoperiodic flowering response.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043
`At5g24470`	Transcriptional repressor of CCA1 and LHY, thereby controlling photoperiodic flowering response.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043
`At5g02810`	Transcriptional repressor of CCA1 and LHY, and positive regulator of LWD1 and LWD2 expression.	Circadian waves of expression of the APRR1/TOC1 family of pseudo-response regulators in Arabidopsis thaliana: insight into the plant circadian clock.2000 · DOI: 10.1093/pcp/pcd043

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0618200`	Controls photoperiodic flowering response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030615 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000160 phosphorelay signal transduction system Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010031 circumnutation Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0010468 regulation of gene expression Biological Process

KEGG gene cross-reference

ath:AT2G46790

ath:AT5G24470

ath:AT5G61380

dosa:Os02g0618200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.922

Rank 1 · TkA07G415400 · TK1151

Cytoplasm0.123

Rank 2 · TkA07G415400 · TK1151

Cell membrane0.051

Rank 3 · TkA07G415400 · TK1151

Endoplasmic reticulum0.029

Rank 4 · TkA07G415400 · TK1151

Plastid0.015

Rank 5 · TkA07G415400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29701TP_0454_N13-98 aa

PF00072Response_reg15-127 aa

PF06203CCT75-85 aa

PF06203CCT380-422 aa

PF09425Jas_motif380-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G415400	`PF29701`	TP_0454_N	13	98	0.0015	19.0
TkA07G415400	`PF00072`	Response_reg	15	127	1.6e-17	64.4
TkA07G415400	`PF06203`	CCT	75	85	4.7e-15	56.1
TkA07G415400	`PF06203`	CCT	380	422	4.7e-15	56.1
TkA07G415400	`PF09425`	Jas_motif	380	402	0.18	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LKL2`	Arabidopsis thaliana	sp\|Q9LKL2\|APRR1_ARATH Two-component response regulator-like APRR1	41.000%	Swiss-Prot	Medium
`Q8L500`	Arabidopsis thaliana	sp\|Q8L500\|APRR9_ARATH Two-component response regulator-like APRR9	30.400%	Swiss-Prot	Medium
`Q9LVG4`	Arabidopsis thaliana	sp\|Q9LVG4\|APRR3_ARATH Two-component response regulator-like APRR3	30.500%	Swiss-Prot	Medium
`Q6LA42`	Arabidopsis thaliana	sp\|Q6LA42\|APRR5_ARATH Two-component response regulator-like APRR5	27.100%	Swiss-Prot	Low
`Q93WK5`	Arabidopsis thaliana	sp\|Q93WK5\|APRR7_ARATH Two-component response regulator-like APRR7	78.300%	Swiss-Prot	Low
`Q689G9`	Oryza sativa subsp. japonica	sp\|Q689G9\|PRR1_ORYSJ Two-component response regulator-like PRR1	43.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card