TkA07G415370 | RubberDandelionOmics

Gene overview

TkA07G415370

Reference: TK1151 Chr: Chr07 Coordinates: 104977604-104979515 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1488 bp · TkA07G415370|TK1151|cDNA

ATGAAGATTTCTGCCATTAAAACCAAGTTCTCACGCACCAGATATCTTTCTCCCCTCTCTTCAGCTTCCTCATTTTCATCTTTTCAGTCGAACCTCGCACACAAAATCCTAAACTCTAGTTCCGCAAGTGAAGCGCTTCAGTTGTATTACTCATCTTTCACGAACACCGATCCCACCAAGAATTTAAAACTGCATTCAGCAACCATCCATTTCTTAACCAATGCAAGGCTATACTTGAAGGCCAGGTGTTTGATAAAAGA...

CDS

Download CDS FASTA

1488 bp · TkA07G415370|TK1151|CDS

ATGAAGATTTCTGCCATTAAAACCAAGTTCTCACGCACCAGATATCTTTCTCCCCTCTCTTCAGCTTCCTCATTTTCATCTTTTCAGTCGAACCTCGCACACAAAATCCTAAACTCTAGTTCCGCAAGTGAAGCGCTTCAGTTGTATTACTCATCTTTCACGAACACCGATCCCACCAAGAATTTAAAACTGCATTCAGCAACCATCCATTTCTTAACCAATGCAAGGCTATACTTGAAGGCCAGGTGTTTGATAAAAGA...

Protein

Download Protein FASTA

495 aa · TkA07G415370|TK1151|PROTEIN

MKISAIKTKFSRTRYLSPLSSASSFSSFQSNLAHKILNSSSASEALQLYYSSFTNTDPTKNLKLHSATIHFLTNARLYLKARCLIKDLIEALNRSCSPHRVCSLLFQALNHPELTQPKTNVFGVLMTALTELGFVDEAYWVLMKTDELPPLQVCKQDFKRVCKGDIHKARNLFDEMLERGMNPNVFIYTTFIRGLCCEGRMLEAESMFAEMNKTGVVPDLYTYNALLDGHCKMANINKALNFYKEILVTKLTPNFVTFGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G415370`
TK1151 ID	TkA07G415370
OH-1004 ID	LXL04_030614
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	70.500
Protein coverage (%)	TK1151 100.000 / OH-1004 97.843 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G415370

Location Chr07:104977604-104979515 (-)

Description Similar to At5g61400: Pentatricopeptide repeat-containing protein At5g61400

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39710`	Pentatricopeptide repeat-containing protein At5g39710.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030614 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000963 mitochondrial RNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0090615 mitochondrial mRNA processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0036002 pre-mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G02150

ath:AT5G61400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.812

Rank 1 · TkA07G415370 · TK1151

Plastid0.083

Rank 2 · TkA07G415370 · TK1151

Nucleus0.048

Rank 3 · TkA07G415370 · TK1151

Cytoplasm0.035

Rank 4 · TkA07G415370 · TK1151

Cell membrane0.009

Rank 5 · TkA07G415370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070MSC6_N20-44 aa

PF25058ARM_TT2135-70 aa

PF17049AEP165-101 aa

PF14689SPOB_a80-93 aa

PF00637Clathrin82-116 aa

PF17177PPR_long102-142 aa

PF24760TPR_IF140_C102-142 aa

PF01535PPR122-143 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G415370	`PF29070`	MSC6_N	20	44	5.5e-15	56.1
TkA07G415370	`PF25058`	ARM_TT21	35	70	0.012	16.3
TkA07G415370	`PF17049`	AEP1	65	101	0.017	14.9
TkA07G415370	`PF14689`	SPOB_a	80	93	0.17	12.3
TkA07G415370	`PF00637`	Clathrin	82	116	0.012	16.1
TkA07G415370	`PF17177`	PPR_long	102	142	1.8e-16	60.9
TkA07G415370	`PF24760`	TPR_IF140_C	102	142	3.6e-06	28.1
TkA07G415370	`PF01535`	PPR	122	143	6e-53	174.2
TkA07G415370	`PF08579`	RPM2	131	168	0.004	18.3
TkA07G415370	`PF12854`	PPR_1	133	139	1.1e-59	198.5
TkA07G415370	`PF29070`	MSC6_N	142	314	5.5e-15	56.1
TkA07G415370	`PF00317`	Ribonuc_red_lgN	160	184	0.11	13.3
TkA07G415370	`PF17177`	PPR_long	161	253	1.8e-16	60.9
TkA07G415370	`PF30397`	MalM_C	161	175	0.00037	21.2
TkA07G415370	`PF13041`	PPR_2	163	196	2.4e-68	226.8
TkA07G415370	`PF12854`	PPR_1	163	176	1.1e-59	198.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIX3`	Arabidopsis thaliana	sp\|Q9FIX3\|PP407_ARATH Pentatricopeptide repeat-containing protein At5g39710	28.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card