TkA07G406660 | RubberDandelionOmics

Gene overview

TkA07G406660

Reference: TK1151 Chr: Chr07 Coordinates: 102227737-102230669 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2730 bp · TkA07G406660|TK1151|cDNA

AAGATGTCGAGAAAGAAAAACCCTAGCAAAATGCTTCTCTCGCTGCAAAGGTGTAGTAGAATCTGGACTTGACGAAACGGAGCGTTCTGCTTGATTGCTTGTAGGTTTATTTTTCGAGCTGATCGAATACGCGGCAATGATGTATATCTGATTTATTTCAGTTCATATGAAAGTGAAACATTCTGCTTAAGCGTCTCTGTTCTACGGTTTCTGGAATAATCGGATTAATCGATTTTGATTCTCGCTTTGTCTGTCGTTCC...

CDS

Download CDS FASTA

1371 bp · TkA07G406660|TK1151|CDS

ATGAATCTGAAGCATTTCTTATCGAGACTGCCAATCAACAAGGCGTCAAGGTTTAACGGTAGAATAACCCCATCATGGAATTACAGAGAGGTTTCCACCACTCGCTGTATTTCCCCTCTTCTTCACGTACCAAACTGTCTTAACGACGACTCCCGGATTCGAAACCCTAAAACGCCGATAACACGTTCATTATTCTCTAGATTCATCCACTCTGGTTCAGAAACTGTTTCGAATGTTACCAATGCTGTATCTACACTTTC...

Protein

Download Protein FASTA

456 aa · TkA07G406660|TK1151|PROTEIN

MNLKHFLSRLPINKASRFNGRITPSWNYREVSTTRCISPLLHVPNCLNDDSRIRNPKTPITRSLFSRFIHSGSETVSNVTNAVSTLSVDSEDDENALMNEFLSRFVWIMRGKLADVYTEADKKEIDAMLQIIVGKVISVVEAGQLESLLDSDSVSSTMSQDFSEDLWKTVWEVCNVVIDDMKKAKKKEKMKSFLQCEEVKDMTRFAGEIGIRGDLLRELRFKWAREKLEDSEFYDYLELLKQESKEESETTQIHNIEEEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G406660`
TK1151 ID	TkA07G406660
OH-1004 ID	LXL04_026821
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	33.000
Protein coverage (%)	TK1151 24.342 / OH-1004 28.212 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G406660

Location Chr07:102227737-102230669 (+)

Description Similar to At1g01970: Pentatricopeptide repeat-containing protein At1g01970

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g19520`	Required for karyogamy during female gametophyte development, when the two polar nuclei fuse to form the diploid central cell nucleus.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026821 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008380 RNA splicing Biological Process

GO:0009880 embryonic pattern specification Biological Process

GO:0048366 leaf development Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G01970

ath:AT5G04810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.759

Rank 1 · TkA07G406660 · TK1151

Plastid0.150

Rank 2 · TkA07G406660 · TK1151

Nucleus0.102

Rank 3 · TkA07G406660 · TK1151

Cytoplasm0.058

Rank 4 · TkA07G406660 · TK1151

Cell membrane0.017

Rank 5 · TkA07G406660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276TPR_2459-87 aa

PF17177PPR_long173-193 aa

PF01535PPR175-191 aa

PF13041PPR_2176-184 aa

PF13181TPR_8185-195 aa

PF03467Smg4_UPF3229-267 aa

PF17177PPR_long231-251 aa

PF23276TPR_24362-448 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G406660	`PF23276`	TPR_24	59	87	0.0023	18.5
TkA07G406660	`PF17177`	PPR_long	173	193	0.0012	19.0
TkA07G406660	`PF01535`	PPR	175	191	1.3e-06	29.0
TkA07G406660	`PF13041`	PPR_2	176	184	6.5e-07	30.1
TkA07G406660	`PF13181`	TPR_8	185	195	0.37	11.8
TkA07G406660	`PF03467`	Smg4_UPF3	229	267	0.61	10.8
TkA07G406660	`PF17177`	PPR_long	231	251	0.0012	19.0
TkA07G406660	`PF23276`	TPR_24	362	448	0.0023	18.5
TkA07G406660	`PF13812`	PPR_3	377	429	4.4e-08	33.8
TkA07G406660	`PF01535`	PPR	388	416	1.3e-06	29.0
TkA07G406660	`PF17177`	PPR_long	388	449	0.0012	19.0
TkA07G406660	`PF13041`	PPR_2	391	432	6.5e-07	30.1
TkA07G406660	`PF12854`	PPR_1	393	412	0.056	13.9
TkA07G406660	`PF13181`	TPR_8	394	410	0.37	11.8
TkA07G406660	`PF12854`	PPR_1	414	441	0.056	13.9
TkA07G406660	`PF13812`	PPR_3	419	447	4.4e-08	33.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LEZ4`	Arabidopsis thaliana	sp\|Q8LEZ4\|NFD5_ARATH Small ribosomal subunit protein mS77 (rPPR2)	42.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card