TkA07G402890 | RubberDandelionOmics

Gene overview

TkA07G402890

Reference: TK1151 Chr: Chr07 Coordinates: 101235842-101237351 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

912 bp · TkA07G402890|TK1151|cDNA

ATGATATTTACATACGTATTCGGTACACTAGAGTTGATTTGCATTATATTTTTCTTTTATAAAACCCGCAATCCACATAAAACCACACAAAGCTACCTGCAAGCTGCAACAGGGTTTAAGAGATTCACGTACGCGGAATTGAAGAAAGCCTCCAGAAATTTCAGCCAAGAAATAGGGAGAGGAGGTGGCGGAATTGTTTACAAAGGAGTATTATCAGACAATCGAATAGCAGCAATCAAGTACCTCAAAGATACTAGAAA...

CDS

Download CDS FASTA

912 bp · TkA07G402890|TK1151|CDS

ATGATATTTACATACGTATTCGGTACACTAGAGTTGATTTGCATTATATTTTTCTTTTATAAAACCCGCAATCCACATAAAACCACACAAAGCTACCTGCAAGCTGCAACAGGGTTTAAGAGATTCACGTACGCGGAATTGAAGAAAGCCTCCAGAAATTTCAGCCAAGAAATAGGGAGAGGAGGTGGCGGAATTGTTTACAAAGGAGTATTATCAGACAATCGAATAGCAGCAATCAAGTACCTCAAAGATACTAGAAA...

Protein

Download Protein FASTA

303 aa · TkA07G402890|TK1151|PROTEIN

MIFTYVFGTLELICIIFFFYKTRNPHKTTQSYLQAATGFKRFTYAELKKASRNFSQEIGRGGGGIVYKGVLSDNRIAAIKYLKDTRNNNNQGEGDILAEISTLGRLNHMNLIQMWGYCAEKKHRILVYEYMENGSLAENLHSGKLDWGKRFEIAVGTAKGLAYLHEECLEWVLHCDVKPHNILLDSDFNPKVADFGLSKLLERDGSCNSEFKKARGTRGYMAPEWLFLNRPITSKVDVYSYGVVMLEMITGRSTCPAGDP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G402890`
TK1151 ID	TkA07G402890
OH-1004 ID	LXL04_008069
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.200
Protein coverage (%)	TK1151 87.459 / OH-1004 28.836 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G402890

Location Chr07:101235842-101237351 (+)

Description Similar to PK1: Putative receptor protein kinase ZmPK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24080`	G-type lectin S-receptor-like serine/threonine-protein kinase At5g24080.	No verified direct reference in this release
`At4g32300`	G-type lectin S-receptor-like serine/threonine-protein kinase SD2-5.	No verified direct reference in this release
`At1g34300`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g34300.	No verified direct reference in this release
`At5g35370`	G-type lectin S-receptor-like serine/threonine-protein kinase At5g35370.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008069 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0051707 response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G19130

ath:AT4G00340

ath:AT5G24080

zma:542378

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.749

Rank 1 · TkA07G402890 · TK1151

Cytoplasm0.126

Rank 2 · TkA07G402890 · TK1151

Endoplasmic reticulum0.123

Rank 3 · TkA07G402890 · TK1151

Nucleus0.065

Rank 4 · TkA07G402890 · TK1151

Golgi apparatus0.046

Rank 5 · TkA07G402890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr54-258 aa

PF00069Pkinase55-262 aa

PF03109ABC164-83 aa

PF03109ABC1122-203 aa

PF12260PIP49_C124-194 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G402890	`PF07714`	PK_Tyr_Ser-Thr	54	258	5e-39	134.9
TkA07G402890	`PF00069`	Pkinase	55	262	1e-51	176.6
TkA07G402890	`PF03109`	ABC1	64	83	0.004	17.1
TkA07G402890	`PF03109`	ABC1	122	203	0.004	17.1
TkA07G402890	`PF12260`	PIP49_C	124	194	0.034	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLV4`	Arabidopsis thaliana	sp\|Q9FLV4\|Y5248_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At5g24080	50.500%	Swiss-Prot	Medium
`Q8RWZ5`	Arabidopsis thaliana	sp\|Q8RWZ5\|SD25_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase SD2-5	47.400%	Swiss-Prot	Medium
`Q9XID3`	Arabidopsis thaliana	sp\|Q9XID3\|Y1343_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At1g34300	47.500%	Swiss-Prot	Medium
`O65238`	Arabidopsis thaliana	sp\|O65238\|Y5537_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At5g35370	49.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card