TkA07G400410 | RubberDandelionOmics

Gene overview

TkA07G400410

Reference: TK1151 Chr: Chr07 Coordinates: 100633154-100636244 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1483 bp · TkA07G400410|TK1151|cDNA

GAAAAACACGTTTTTCTCCACAAGAGAACCAAACACTCTGAAATCCGACTCGTTTGTGTATGTGCGTTTGCTTATCGACCTTTACTACTACAGGCGACGATTACAATGGCGAACTTGAAGGCGGATTCTCCTCTTTGTCGTCGCATCGCTCTATCTGTCATTGACTTCCTCACTTCTGTTGAACCTACCTCCGCTAGTGATGCTGAAAGCCTTGAGGTTGCAAAAGACTGTTTATCTGAGGTTTTCAAGGTTGATTCATC...

CDS

Download CDS FASTA

1371 bp · TkA07G400410|TK1151|CDS

GAAAAACACGTTTTTCTCCACAAGAGAACCAAACACTCTGAAATCCGACTCGTTTGTGTATGTGCGTTTGCTTATCGACCTTTACTACTACAGGCGACGATTACAATGGCGAACTTGAAGGCGGATTCTCCTCTTTGTCGTCGCATCGCTCTATCTGTCATTGACTTCCTCACTTCTGTTGAACCTACCTCCGCTAGTGATGCTGAAAGCCTTGAGGTTGCAAAAGACTGTTTATCTGAGGTTTTCAAGGTTGATTCATC...

Protein

Download Protein FASTA

456 aa · TkA07G400410|TK1151|PROTEIN

EKHVFLHKRTKHSEIRLVCVCAFAYRPLLLQATITMANLKADSPLCRRIALSVIDFLTSVEPTSASDAESLEVAKDCLSEVFKVDSSSTSSLPKSDSLIQIFSSQTGKNEIKSDQSHEEPQANTSSTSCTNNAADTKIPGTSQSLSDTDKGNAQPIGVLEDELFGQFFSSLEKIHYFGSTPNGDDEQALERATKLFHNALMEMKKSGSDEFDLKKLADTFKLQGNKAMQSKLYSDAIELYTISIALCDDNAVYYCNRAAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G400410`
TK1151 ID	TkA07G400410
OH-1004 ID	LXL04_005175
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	43.800
Protein coverage (%)	TK1151 18.860 / OH-1004 12.015 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G400410`
Location	Chr07:100633154-100636244 (-)
Description	Similar to DNAJC7: DnaJ homolog subfamily C member 7
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005175` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:1900034 regulation of cellular response to heat Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005856 cytoskeleton Cellular Component GO:0016020 membrane Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0001671 ATPase activator activity Molecular Function GO:0031072 heat shock protein binding Molecular Function
KEGG gene cross-reference	hsa:7266 mmu:56354 pon:100173101 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.699

Rank 1 · TkA07G400410 · TK1151

Nucleus0.407

Rank 2 · TkA07G400410 · TK1151

Mitochondrion0.098

Rank 3 · TkA07G400410 · TK1151

Peroxisome0.075

Rank 4 · TkA07G400410 · TK1151

Endoplasmic reticulum0.071

Rank 5 · TkA07G400410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16546SGTA_dimer47-103 aa

PF13371TPR_950-66 aa

PF23914TPR_CcmH_CycH65-88 aa

PF30484ETO1_C66-85 aa

PF13374TPR_10185-196 aa

PF14559TPR_19186-205 aa

PF07719TPR_2189-199 aa

PF13176TPR_7190-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G400410	`PF16546`	SGTA_dimer	47	103	4.3e-12	46.3
TkA07G400410	`PF13371`	TPR_9	50	66	0.055	14.2
TkA07G400410	`PF23914`	TPR_CcmH_CycH	65	88	0.023	15.3
TkA07G400410	`PF30484`	ETO1_C	66	85	0.026	14.4
TkA07G400410	`PF13374`	TPR_10	185	196	3.2e-06	27.6
TkA07G400410	`PF14559`	TPR_19	186	205	9.4e-08	33.0
TkA07G400410	`PF07719`	TPR_2	189	199	1.1e-14	53.9
TkA07G400410	`PF13176`	TPR_7	190	204	0.0045	17.7
TkA07G400410	`PF13424`	TPR_12	214	240	5.2e-05	24.1
TkA07G400410	`PF13174`	TPR_6	215	227	0.2	13.1
TkA07G400410	`PF13181`	TPR_8	216	239	1.4e-06	28.7
TkA07G400410	`PF00515`	TPR_1	217	249	7e-18	64.3
TkA07G400410	`PF23914`	TPR_CcmH_CycH	218	241	0.023	15.3
TkA07G400410	`PF25575`	TPR_BSK1_C	219	288	1.1e-05	26.1
TkA07G400410	`PF25063`	ARM_TT21_C	219	286	0.0018	18.9
TkA07G400410	`PF07719`	TPR_2	220	250	1.1e-14	53.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card