TkA07G400390 | RubberDandelionOmics

Gene overview

TkA07G400390

Reference: TK1151 Chr: Chr07 Coordinates: 100625191-100628204 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2819 bp · TkA07G400390|TK1151|cDNA

TTGGCGCGTGCCGTTCTCCACTTTCCACTTCTTCGGTTCTTCCCCGTCCACCTCTCGAACTCACAGGACATAGGCTATCAGAAACCGTAACCCTAATCATTACCCAACTTAACTGTCGGAGATTACTAAGACGAGAGATTGTTACCAAGAGAGCTTGTGCTTGTAAATGGTGTTTTCTTTCAGTAAAAGCTTGATGCTTTAATTCTACCCTTCGCCGTGGTACCAACGCCCAATAAGGATTGCCGGAAGTCAGACCGGCG...

CDS

Download CDS FASTA

2439 bp · TkA07G400390|TK1151|CDS

ATGTGGTCTGTACGTCTACCAATGATTTGCAGAAGGAAACTTATAAACAGGACAACAAATCTTCATGTATGTTTCAACCTCAATTCGGCTAATCTGTTACCTATTGACAGAGGAAAAAGATATATCAGTCATTCAGTTGATTCGTCTCTAAAATCCAGTAACAATGGAAACAACAATACCATTGACAAAATGTCATTAGCAAGTAACTTAGCCTCTTTGGTGGAAGAGTCTTCTGTGATTAATGAAAGGAAACCAAGAAC...

Protein

Download Protein FASTA

812 aa · TkA07G400390|TK1151|PROTEIN

MWSVRLPMICRRKLINRTTNLHVCFNLNSANLLPIDRGKRYISHSVDSSLKSSNNGNNNTIDKMSLASNLASLVEESSVINERKPRTRLELKRFLESRIKKTVKSQFKDGKFHNLIENVIANPYTLQDAYDSIRVNSNINLLSESDNIPFDSLAQELSSGTFDITANTYSMSTKGSKREKEKLVLPNLKLTIIQEAIRIALEVVYKPHYSKISHGCRIGRGHVSALKYIRKEISNSDWFFTVEVNKKVDNSTLSNLISTM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G400390`
TK1151 ID	TkA07G400390
OH-1004 ID	LXL04_000324
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	26.800
Protein coverage (%)	TK1151 87.192 / OH-1004 92.053 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G400390

Location Chr07:100625191-100628204 (+)

Description Similar to NMAT3: Nuclear intron maturase 3, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g74350`	Nuclear-encoded maturase required for splicing of group-II introns in mitochondria.	nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation, is essential for holocomplex I biogenesis in Arabidopsis mitochondria.2014 · DOI: 10.1111/tpj.12466
`At5g04050`	Nuclear-encoded maturase required for splicing of group-II introns in mitochondria.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000324 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006278 RNA-templated DNA biosynthetic process Biological Process

GO:0006314 intron homing Biological Process

GO:0006315 homing of group II introns Biological Process

GO:0006397 mRNA processing Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009845 seed germination Biological Process

GO:0032885 regulation of polysaccharide biosynthetic process Biological Process

GO:0090351 seedling development Biological Process

GO:0090615 mitochondrial mRNA processing Biological Process

KEGG gene cross-reference

ath:AT1G74350

ath:AT5G04050

ppt:PPS_0381

sce:Q0050

sce:Q0055

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.873

Rank 1 · TkA07G400390 · TK1151

Nucleus0.081

Rank 2 · TkA07G400390 · TK1151

Cytoplasm0.073

Rank 3 · TkA07G400390 · TK1151

Plastid0.032

Rank 4 · TkA07G400390 · TK1151

Cell membrane0.022

Rank 5 · TkA07G400390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00078RVT_1126-141 aa

PF00078RVT_1183-405 aa

PF01348Intron_maturas2593-699 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G400390	`PF00078`	RVT_1	126	141	2.5e-07	31.5
TkA07G400390	`PF00078`	RVT_1	183	405	2.5e-07	31.5
TkA07G400390	`PF01348`	Intron_maturas2	593	699	1.8e-11	44.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CA78`	Arabidopsis thaliana	sp\|Q9CA78\|NMAT4_ARATH Nuclear intron maturase 4, mitochondrial	51.900%	Swiss-Prot	High
`Q9LZA5`	Arabidopsis thaliana	sp\|Q9LZA5\|NMAT3_ARATH Nuclear intron maturase 3, mitochondrial	25.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card