TkA07G375560 | RubberDandelionOmics

Gene overview

TkA07G375560

Reference: TK1151 Chr: Chr07 Coordinates: 94234916-94237434 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1141 bp · TkA07G375560|TK1151|cDNA

TGTACATAAAATGTCGACGATTACTGTTCCGGCAGAAGTTCCTCCCGTCTCCGACGACGTTGAGCAGCTCCATAAAGCTTTTGAAGGATGGGGAACAAATGAGGGTTTGATCATCGTGATTTTAGCTCACAGAAACGCAGACCAACGTAAGCTTATCCGCCATACATATGCCGAGACTTACAAAGAAGATCTCCTTAAAGCACTCGAAAAGGAACTCACAAGCGACTTCGAGAGGATCGTTCTTGTCTGGACACTTGATC...

CDS

Download CDS FASTA

951 bp · TkA07G375560|TK1151|CDS

ATGTCGACGATTACTGTTCCGGCAGAAGTTCCTCCCGTCTCCGACGACGTTGAGCAGCTCCATAAAGCTTTTGAAGGATGGGGAACAAATGAGGGTTTGATCATCGTGATTTTAGCTCACAGAAACGCAGACCAACGTAAGCTTATCCGCCATACATATGCCGAGACTTACAAAGAAGATCTCCTTAAAGCACTCGAAAAGGAACTCACAAGCGACTTCGAGAGGATCGTTCTTGTCTGGACACTTGATCCACCTGAAAG...

Protein

Download Protein FASTA

316 aa · TkA07G375560|TK1151|PROTEIN

MSTITVPAEVPPVSDDVEQLHKAFEGWGTNEGLIIVILAHRNADQRKLIRHTYAETYKEDLLKALEKELTSDFERIVLVWTLDPPERDAFLANEAIKKGAKSNQIIAEIACTRSSQDLLLAKKAYHLRYQKSMEEDVASSTTADFRKLLWPLVTSYRYEGEEIDMSLAKTEAKLLHDKITEKCYNDDDFIRIITTRSKPQIQATLNNYKNEFGQDINKDLKADPKDEFLMILRATIKCLTCPVKYFEKRLRLAINRTGTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G375560`
TK1151 ID	TkA07G375560
OH-1004 ID	LXL04_030102
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G375560

Location Chr07:94234916-94237434 (+)

Description Similar to ANN2: Annexin D2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65020`	May mediate regulated, targeted secretion of Golgi-derived vesicles during seedling development.	No verified direct reference in this release
`At1g35720`	Has a peroxidase activity.	Immunolocalization and histochemical evidence for the association of two different Arabidopsis annexins with secretion during early seedling growth and development.2005 · DOI: 10.1007/s00425-004-1374-7 Peroxidase activity of annexin 1 from Arabidopsis thaliana.2005 · DOI: 10.1016/j.bbrc.2005.08.181
`At5g10230`	Annexin D7.	No verified direct reference in this release
`At5g10220`	Annexin D6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030102 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009835 fruit ripening Biological Process

GO:0015774 polysaccharide transport Biological Process

GO:0017156 calcium-ion regulated exocytosis Biological Process

GO:0032940 secretion by cell Biological Process

KEGG gene cross-reference

ath:AT1G35720

ath:AT5G10220

ath:AT5G10230

ath:AT5G65020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.501

Rank 1 · TkA07G375560 · TK1151

Cell membrane0.348

Rank 2 · TkA07G375560 · TK1151

Nucleus0.213

Rank 3 · TkA07G375560 · TK1151

Extracellular0.073

Rank 4 · TkA07G375560 · TK1151

Mitochondrion0.062

Rank 5 · TkA07G375560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15963Myb_DNA-bind_715-74 aa

PF00191Annexin16-79 aa

PF00191Annexin88-150 aa

PF00191Annexin171-228 aa

PF15963Myb_DNA-bind_7195-220 aa

PF00191Annexin245-310 aa

PF15963Myb_DNA-bind_7253-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G375560	`PF15963`	Myb_DNA-bind_7	15	74	0.22	12.1
TkA07G375560	`PF00191`	Annexin	16	79	6.6e-69	228.7
TkA07G375560	`PF00191`	Annexin	88	150	6.6e-69	228.7
TkA07G375560	`PF00191`	Annexin	171	228	6.6e-69	228.7
TkA07G375560	`PF15963`	Myb_DNA-bind_7	195	220	0.22	12.1
TkA07G375560	`PF00191`	Annexin	245	310	6.6e-69	228.7
TkA07G375560	`PF15963`	Myb_DNA-bind_7	253	303	0.22	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XEE2`	Arabidopsis thaliana	sp\|Q9XEE2\|ANXD2_ARATH Annexin D2	62.100%	Swiss-Prot	High
`Q9SYT0`	Arabidopsis thaliana	sp\|Q9SYT0\|ANXD1_ARATH Annexin D1	62.500%	Swiss-Prot	High
`Q9LX07`	Arabidopsis thaliana	sp\|Q9LX07\|ANXD7_ARATH Annexin D7	61.500%	Swiss-Prot	High
`Q9LX08`	Arabidopsis thaliana	sp\|Q9LX08\|ANXD6_ARATH Annexin D6	60.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card