TkA07G374010 | RubberDandelionOmics

Gene overview

TkA07G374010

Reference: TK1151 Chr: Chr07 Coordinates: 93824105-93828302 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

478 bp · TkA07G374010|TK1151|cDNA

AAAATATAAAACATAGACCATAGATCAAAATCATGTATGCATTTCATGTTATTAAATGGCTATAAATACGTACGATGATCCAAGAGCCTAAACCACAATAATCCCCTGGAACCAAATATAAAGTGCTAGCCCTCTATAACCATATATAGGCATGGCCTTCTTCAAAGCTTCATGCTTAGCAACACTGTTTTTTGCATTATTATCATGCAATTTGAGAGCTTCAGAAGCTCAAACACCAGCAGTGACAGACGGACTGTCTT...

CDS

Download CDS FASTA

1056 bp · TkA07G374010|TK1151|CDS

ATGGCCTTCTTCAAAGCTTCATGCTTAGCAACACTGTTTTTTGCATTATTATCATGCAATTTGAGAGCTTCAGAAGCTCAAACACCAGCAGTGACAGACGGACTGTCTTTTACATTTCATGAAAATACTTGTCCACAGCTAGAATCCATTGTGCGGCAACAACTTCTGGCCGATTTTGCTTCTGATATAGGCCAAGCTGCTGGTTTGCTTCGACTTCATTTCCACGATTGCTTTGTTCAAGGTTGTGATGGCTCGGTGTT...

Protein

Download Protein FASTA

351 aa · TkA07G374010|TK1151|PROTEIN

MAFFKASCLATLFFALLSCNLRASEAQTPAVTDGLSFTFHENTCPQLESIVRQQLLADFASDIGQAAGLLRLHFHDCFVQGCDGSVLLINSTSGPDEQDAPPNLTLRSQAFAIIENLRALVHSACNQTVSCSDITALAARDAVFLSGGPNYSIPLGRRDGLNFATINETLANLPAPTADTTALLTSLATKGFDTTDVVALSGGHTIGIANCGSFVGRIIPTQDPTLNETLAIDLRNTCPTNVTSNTTFMDVLSPNAFDNS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G374010`
TK1151 ID	TkA07G374010
OH-1004 ID	LXL04_030061
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G374010

Location Chr07:93824105-93828302 (+)

Description Similar to PER12: Peroxidase 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71695`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At5g06730`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At3g21770`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At3g32980`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At5g64120`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0677200`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`Os05g0499300`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030061 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0051707 response to other organism Biological Process

GO:0080001 mucilage extrusion from seed coat Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004601 peroxidase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G71695

ath:AT2G18150

ath:AT4G36430

dosa:Os05g0499300

sbi:8074114

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.346

Rank 1 · TkA07G374010 · TK1151

Cell membrane0.161

Rank 2 · TkA07G374010 · TK1151

Lysosome / Vacuole0.146

Rank 3 · TkA07G374010 · TK1151

Endoplasmic reticulum0.108

Rank 4 · TkA07G374010 · TK1151

Cytoplasm0.102

Rank 5 · TkA07G374010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141peroxidase51-294 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G374010	`PF00141`	peroxidase	51	294	2e-77	260.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q96520`	Arabidopsis thaliana	sp\|Q96520\|PER12_ARATH Peroxidase 12	60.300%	Swiss-Prot	High
`Q9FG34`	Arabidopsis thaliana	sp\|Q9FG34\|PER54_ARATH Peroxidase 54	44.300%	Swiss-Prot	Medium
`Q9LSY7`	Arabidopsis thaliana	sp\|Q9LSY7\|PER30_ARATH Peroxidase 30	50.400%	Swiss-Prot	High
`Q9LHB9`	Arabidopsis thaliana	sp\|Q9LHB9\|PER32_ARATH Peroxidase 32	45.300%	Swiss-Prot	Medium
`Q43387`	Arabidopsis thaliana	sp\|Q43387\|PER71_ARATH Peroxidase 71	40.200%	Swiss-Prot	Medium
`Q7F1U0`	Oryza sativa subsp. japonica	sp\|Q7F1U0\|PER22_ORYSJ Peroxidase 22.3	44.900%	Swiss-Prot	Medium
`P37834`	Oryza sativa subsp. japonica	sp\|P37834\|PER1_ORYSJ Peroxidase 1	44.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card